Human CCR7/BLR2/ CC-CKR-7 ORF/cDNA clone-Lentivirus plasmid (NM_001838)
Pre-made Human CCR7/BLR2/ CC-CKR-7 Lentiviral expression plasmid for CCR7 lentivirus packaging, CCR7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCR7/BLR2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003944 | Human CCR7 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003944 |
Gene Name | CCR7 |
Accession Number | NM_001838 |
Gene ID | 1236 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1137 bp |
Gene Alias | BLR2, CC-CKR-7, CCR-7, CD197, CDw197, CMKBR7, EBI1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCTGGGGAAACCAATGAAAAGCGTGCTGGTGGTGGCTCTCCTTGTCATTTTCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACCGCTACGTGGCCATCGTCCAGGCTGTCTCAGCTCACCGCCACCGTGCCCGCGTCCTTCTCATCAGCAAGCTGTCCTGTGTGGGCATCTGGATACTAGCCACAGTGCTCTCCATCCCAGAGCTCCTGTACAGTGACCTCCAGAGGAGCAGCAGTGAGCAAGCGATGCGATGCTCTCTCATCACAGAGCATGTGGAGGCCTTTATCACCATCCAGGTGGCCCAGATGGTGATCGGCTTTCTGGTCCCCCTGCTGGCCATGAGCTTCTGTTACCTTGTCATCATCCGCACCCTGCTCCAGGCACGCAACTTTGAGCGCAACAAGGCCATCAAGGTGATCATCGCTGTGGTCGTGGTCTTCATAGTCTTCCAGCTGCCCTACAATGGGGTGGTCCTGGCCCAGACGGTGGCCAACTTCAACATCACCAGTAGCACCTGTGAGCTCAGTAAGCAACTCAACATCGCCTACGACGTCACCTACAGCCTGGCCTGCGTCCGCTGCTGCGTCAACCCTTTCTTGTACGCCTTCATCGGCGTCAAGTTCCGCAACGATCTCTTCAAGCTCTTCAAGGACCTGGGCTGCCTCAGCCAGGAGCAGCTCCGGCAGTGGTCTTCCTGTCGGCACATCCGGCGCTCCTCCATGAGTGTGGAGGCCGAGACCACCACCACCTTCTCCCCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T84981-Ab | Anti-CCR7/ BLR2/ CC-CKR-7 monoclonal antibody |
Target Antigen | GM-Tg-g-T84981-Ag | CCR7 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T84981 | chemokine (C-C motif) receptor 7 (CCR7) protein & antibody |
ORF Viral Vector | pGMLV001474 | Human CCR7 Lentivirus plasmid |
ORF Viral Vector | pGMPC000029 | Human CCR7 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003944 | Human CCR7 Lentivirus plasmid |
ORF Viral Vector | vGMLV001474 | Human CCR7 Lentivirus particle |
ORF Viral Vector | vGMLP003944 | Human CCR7 Lentivirus particle |
Target information
Target ID | GM-T84981 |
Target Name | CCR7 |
Gene ID | 1236, 12775, 574231, 287673, 101084327, 491011, 510668, 100067673 |
Gene Symbol and Synonyms | BLR2,CC-CKR-7,CCR-7,CCR7,CD197,CDw197,CMKBR7,EBI1,Ebi1h |
Uniprot Accession | P32248 |
Uniprot Entry Name | CCR7_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000126353 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.