Human DDB2 ORF/cDNA clone-Lentivirus plasmid (BC000093)

Cat. No.: pGMLP003996
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DDB2/ Lentiviral expression plasmid for DDB2 lentivirus packaging, DDB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DDB2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $659.52
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003996
Gene Name DDB2
Accession Number BC000093
Gene ID 1643
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1284 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCCCAAGAAACGCCCAGAAACCCAGAAGACCTCCGAGATTGTATTACGCCCCAGGAACAAGAGGAGCAGGAGTCCCCTGGAGCTGGAGCCCGAGGCCAAGAAGCTCTGTGCGAAGGGCTCCGGTCCTAGCAGAAGATGTGACTCAGACTGCCTCTGGGTGGGGCTGGCTGGCCCACAGATCCTGCCACCATGCCGCAGCATCGTCAGGACCCTCCACCAGCATAAGCTGGGCAGAGCTTCCTGGCCATCTGTCCAGCAGGGGCTCCAGCAGTCCTTTTTGCACACTCTGGATTCTTACCGGATATTACAAAAGGCTGCCCCCTTTGACAGGAGGGCTACATCCTTGGCGTGGCACCCAACTCACCCCAGCACCGTGGCTGTGGGTTCCAAAGGGGGAGATATCATGCTCTGGAATTTTGGCATCAAGGACAAACCCACCTTCATCAAAGGGATTGGAGCTGGAGGGAGCATCACTGGGCTGAAGTTTAACCCTCTCAATACCAACCAGTTTTACGCCTCCTCAATGGAGGGAACAACTAGGCTGCAAGACTTTAAAGGCAACATTCTACGAGTTTTTGCCAGCTCAGACACCATCAACATCTGGTTTTGTAGCCTGGATGTGTCTGCTAGTAGCCGAATGGTGGTCACAGGAGACAACGTGGGGAACGTGATCCTGCTGAACATGGACGGCAAAGAGCTTTGGAATCTCAGAATGCACAAAAAGAAAGTGACGCATGTGGCCCTGAACCCATGCTGTGATTGGTTCCTGGCCACAGCCTCCGTAGATCAAACAGTGAAAATTTGGGACCTGCGCCAGGTTAGAGGGAAAGCCAGCTTCCTCTACTCGCTGCCGCACAGGCATCCTGTCAACGCAGCTTGTTTCAGTCCCGATGGAGCCCGGCTCCTGACCACGGACCAGAAGAGCGAGATCCGAGTTTACTCTGCTTCCCAGTGGGACTGCCCCCTGGGCCTGATCCCGCACCCTCACCGTCACTTCCAGCACCTCACACCTATCAAGGCAGCCTGGCATCCTCGCTACAACCTCATTGTTGTGGGCCGATACCCAGATCCTAATTTCAAAAGTTGTACCCCTTATGAATTGAGGACGATCGACGTGTTCGATGGAAACTCAGGGAAGATGATGTGTCAGCTCTATGACCCAGAATCTTCTGGCATCAGTTCGCTTAATGAATTCAATCCCATGGGGGACACGCTGGCCTCTGCAATGGGTTACCACATTCTCATCTGGAGCCAGGAGGAAGCCAGGACACGGAAGTGA
ORF Protein Sequence MAPKKRPETQKTSEIVLRPRNKRSRSPLELEPEAKKLCAKGSGPSRRCDSDCLWVGLAGPQILPPCRSIVRTLHQHKLGRASWPSVQQGLQQSFLHTLDSYRILQKAAPFDRRATSLAWHPTHPSTVAVGSKGGDIMLWNFGIKDKPTFIKGIGAGGSITGLKFNPLNTNQFYASSMEGTTRLQDFKGNILRVFASSDTINIWFCSLDVSASSRMVVTGDNVGNVILLNMDGKELWNLRMHKKKVTHVALNPCCDWFLATASVDQTVKIWDLRQVRGKASFLYSLPHRHPVNAACFSPDGARLLTTDQKSEIRVYSASQWDCPLGLIPHPHRHFQHLTPIKAAWHPRYNLIVVGRYPDPNFKSCTPYELRTIDVFDGNSGKMMCQLYDPESSGISSLNEFNPMGDTLASAMGYHILIWSQEEARTRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2450-Ab Anti-DDB2 monoclonal antibody
    Target Antigen GM-Tg-g-IP2450-Ag DDB2 protein
    ORF Viral Vector pGMLP003996 Human DDB2 Lentivirus plasmid
    ORF Viral Vector vGMLP003996 Human DDB2 Lentivirus particle


    Target information

    Target ID GM-IP2450
    Target Name DDB2
    Gene ID 1643, 107986, 100362121, 101092211, 483626, 519357, 100051180
    Gene Symbol and Synonyms 2610043A19Rik,DDB2,DDBB,UV-DDB2,XPE
    Uniprot Accession Q92466
    Uniprot Entry Name DDB2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000134574
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.