Human RNF34/CARP-1/CARP1 ORF/cDNA clone-Lentivirus plasmid (NM_194271)

Cat. No.: pGMLP004160
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RNF34/CARP-1/CARP1 Lentiviral expression plasmid for RNF34 lentivirus packaging, RNF34 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RNF34/CARP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $614.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004160
Gene Name RNF34
Accession Number NM_194271
Gene ID 80196
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1122 bp
Gene Alias CARP-1,CARP1,hRFI,RFI,RIF,RIFF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAAGGCGGGTGCCACGTCTATGTGGGCTTCGTGCTGTGGGCTGCTGAATGAAGTCATGGGAACTGGAGCTGTCAGGGGCCAGCAGTCAGCATTTGCAGGAGCCACCGGTCCATTCAGATTTACACCAAACCCTGAGTTTTCCACCTACCCACCAGCAGCTACGGAAGGGCCCAACATAGTTTGTAAAGCCTGTGGGCTTTCATTTTCAGTCTTTAGAAAGAAGCATGTTTGCTGTGACTGCAAGAAGGATTTTTGCTCCGTTTGTTCAGTCTTACAAGAAAATCTCCGTAGATGTTCTACTTGTCACTTATTACAAGAGACAGCATTTCAGCGCCCTCAGTTAATGCGACTGAAGGTGAAGGACCTGCGGCAGTATCTCATTCTGAGAAATATACCCATAGATACTTGTCGTGAGAAAGAAGACTTGGTGGATCTAGTACTGTGCCATCATGGACTAGGCTCTGAGGACGACATGGACACAAGCAGTCTGAATTCTTCAAGGTCCCAGACTTCTAGCTTTTTTACACGTTCGTTTTTTTCAAACTATACAGCCCCCTCTGCTACTATGTCTTCGTTTCAGGGAGAGCTTATGGATGGAGACCAAACATCCAGATCTGGAGTGCCGGCACAGGTACAAAGTGAAATCACTTCAGCAAACACAGAAGATGATGATGACGACGATGATGAGGATGATGATGATGAAGAAGAAAACGCAGAGGATCGGAACCCCGGGCTCTCCAAGGAGAGAGTGAGAGCTTCACTGTCTGACTTGTCAAGCCTTGATGATGTGGAAGGAATGAGCGTGCGCCAGCTGAAGGAAATTCTGGCTCGGAATTTTGTCAACTATTCTGGCTGTTGTGAAAAATGGGAACTGGTAGAGAAAGTAAACCGGTTATACAAAGAGAATGAAGAAAACCAAAAGTCCTATGGCGAGCGGCTGCAGCTGCAGGATGAGGAAGACGACAGCCTGTGTCGCATCTGCATGGATGCCGTCATCGACTGTGTCCTACTGGAGTGTGGGCACATGGTTACCTGCACCAAGTGCGGCAAGCGCATGAGTGAGTGTCCCATCTGCCGGCAGTATGTGGTGCGAGCCGTGCACGTGTTCAAGTCCTGA
ORF Protein Sequence MRKAGATSMWASCCGLLNEVMGTGAVRGQQSAFAGATGPFRFTPNPEFSTYPPAATEGPNIVCKACGLSFSVFRKKHVCCDCKKDFCSVCSVLQENLRRCSTCHLLQETAFQRPQLMRLKVKDLRQYLILRNIPIDTCREKEDLVDLVLCHHGLGSEDDMDTSSLNSSRSQTSSFFTRSFFSNYTAPSATMSSFQGELMDGDQTSRSGVPAQVQSEITSANTEDDDDDDDEDDDDEEENAEDRNPGLSKERVRASLSDLSSLDDVEGMSVRQLKEILARNFVNYSGCCEKWELVEKVNRLYKENEENQKSYGERLQLQDEEDDSLCRICMDAVIDCVLLECGHMVTCTKCGKRMSECPICRQYVVRAVHVFKS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68265-Ab Anti-RNF34 monoclonal antibody
    Target Antigen GM-Tg-g-T68265-Ag RNF34 protein
    ORF Viral Vector pGMLP004160 Human RNF34 Lentivirus plasmid
    ORF Viral Vector vGMLP004160 Human RNF34 Lentivirus particle


    Target information

    Target ID GM-T68265
    Target Name RNF34
    Gene ID 80196, 80751, 700062, 282845, 101094706, 477470, 506764, 100059653
    Gene Symbol and Synonyms CARP-1,CARP1,hRFI,Momo,RFI,RIF,RIFF,RNF34
    Uniprot Accession Q969K3
    Uniprot Entry Name RNF34_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170633
    Target Classification Not Available

    The protein encoded by this gene contains a RINF finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein interacts with DNAJA3/hTid-1, which is a DnaJ protein reported to function as a modulator of apoptosis. Overexpression of this gene in Hela cells was shown to confer the resistance to TNF-alpha induced apoptosis, suggesting an anti-apoptotic function of this protein. This protein can be cleaved by caspase-3 during the induction of apoptosis. This protein also targets p53 and phospho-p53 for degradation. Alternatively splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.