Human LY6K/CT97/HSJ001348 ORF/cDNA clone-Lentivirus plasmid (NM_017527)

Cat. No.: pGMLP004174
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LY6K/CT97/HSJ001348 Lentiviral expression plasmid for LY6K lentivirus packaging, LY6K lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to LY6K/CT97 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004174
Gene Name LY6K
Accession Number NM_017527
Gene ID 54742
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 498 bp
Gene Alias CT97,HSJ001348,ly-6K,URLC10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCTGCTCGCCTTGCTGCTGGTCGTGGCCCTACCGCGGGTGTGGACAGACGCCAACCTGACTGCGAGACAACGAGATCCAGAGGACTCCCAGCGAACGGACGAGGGTGACAATAGAGTGTGGTGTCATGTTTGTGAGAGAGAAAACACTTTCGAGTGCCAGAACCCAAGGAGGTGCAAATGGACAGAGCCATACTGCGTTATAGCGGCCGTGAAAATATTTCCACGTTTTTTCATGGTTGCGAAGCAGTGCTCCGCTGGTTGTGCAGCGATGGAGAGACCCAAGCCAGAGGAGAAGCGGTTTCTCCTGGAAGAGCCCATGCCCTTCTTTTACCTCAAGTGTTGTAAAATTCGCTACTGCAATTTAGAGGGGCCACCTATCAACTCATCAGTGTTCAAAGAATATGCTGGGAGCATGGGTGAGAGCTGTGGTGGGCTGTGGCTGGCCATCCTCCTGCTGCTGGCCTCCATTGCAGCCGGCCTCAGCCTGTCTTGA
ORF Protein Sequence MALLALLLVVALPRVWTDANLTARQRDPEDSQRTDEGDNRVWCHVCERENTFECQNPRRCKWTEPYCVIAAVKIFPRFFMVAKQCSAGCAAMERPKPEEKRFLLEEPMPFFYLKCCKIRYCNLEGPPINSSVFKEYAGSMGESCGGLWLAILLLLASIAAGLSLS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57843-Ab Anti-LY6K/ CT97/ HSJ001348 monoclonal antibody
    Target Antigen GM-Tg-g-T57843-Ag LY6K VLP (virus-like particle)
    ORF Viral Vector pGMLP004174 Human LY6K Lentivirus plasmid
    ORF Viral Vector vGMLP004174 Human LY6K Lentivirus particle


    Target information

    Target ID GM-T57843
    Target Name LY6K
    Gene ID 54742, 76486, 703629, 102899481, 119874439
    Gene Symbol and Synonyms 2410015A16Rik,3110035B01Rik,CT97,HSJ001348,ly-6K,LY6K,mLy-6K,URLC10
    Uniprot Accession Q17RY6
    Uniprot Entry Name LY6K_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000160886
    Target Classification Not Available

    Predicted to be involved in binding activity of sperm to zona pellucida. Predicted to act upstream of or within flagellated sperm motility. Predicted to be located in cell surface; cytoplasm; and plasma membrane. Predicted to be active in acrosomal vesicle. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.