Human FGF10 ORF/cDNA clone-Lentivirus plasmid (NM_004465)
Pre-made Human FGF10/ Lentiviral expression plasmid for FGF10 lentivirus packaging, FGF10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FGF10/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004179 | Human FGF10 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004179 |
Gene Name | FGF10 |
Accession Number | NM_004465 |
Gene ID | 2255 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 627 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGAAATGGATACTGACACATTGTGCCTCAGCCTTTCCCCACCTGCCCGGCTGCTGCTGCTGCTGCTTTTTGTTGCTGTTCTTGGTGTCTTCCGTCCCTGTCACCTGCCAAGCCCTTGGTCAGGACATGGTGTCACCAGAGGCCACCAACTCTTCTTCCTCCTCCTTCTCCTCTCCTTCCAGCGCGGGAAGGCATGTGCGGAGCTACAATCACCTTCAAGGAGATGTCCGCTGGAGAAAGCTATTCTCTTTCACCAAGTACTTTCTCAAGATTGAGAAGAACGGGAAGGTCAGCGGGACCAAGAAGGAGAACTGCCCGTACAGCATCCTGGAGATAACATCAGTAGAAATCGGAGTTGTTGCCGTCAAAGCCATTAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTCTATGGCTCAAAAGAATTTAACAATGACTGTAAGCTGAAGGAGAGGATAGAGGAAAATGGATACAATACCTATGCATCATTTAACTGGCAGCATAATGGGAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCTCCAAGGAGAGGACAGAAAACACGAAGGAAAAACACCTCTGCTCACTTTCTTCCAATGGTGGTACACTCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T62763-Ab | Anti-FGF10 monoclonal antibody |
Target Antigen | GM-Tg-g-T62763-Ag | FGF10 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T62763 | fibroblast growth factor 10 (FGF10) protein & antibody |
ORF Viral Vector | pGMLP004179 | Human FGF10 Lentivirus plasmid |
ORF Viral Vector | vGMLP004179 | Human FGF10 Lentivirus particle |
Target information
Target ID | GM-T62763 |
Target Name | FGF10 |
Gene ID | 2255, 14165, 701584, 25443, 101090489, 612454, 326285, 100052655 |
Gene Symbol and Synonyms | AEY17,Fgf-10,FGF10,Fgf5a,Gsfaey17,LADD3 |
Uniprot Accession | O15520 |
Uniprot Entry Name | FGF10_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000070193 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.