Human GPR68/AI2A6/GPR12A ORF/cDNA clone-Lentivirus plasmid (NM_003485)

Cat. No.: pGMLP004182
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPR68/AI2A6/GPR12A Lentiviral expression plasmid for GPR68 lentivirus packaging, GPR68 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GPR68/AI2A6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $607.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004182
Gene Name GPR68
Accession Number NM_003485
Gene ID 8111
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias AI2A6,GPR12A,OGR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAACATCACTGCAGACAACTCCTCGATGAGCTGTACCATCGACCATACCATCCACCAGACGCTGGCCCCGGTGGTCTATGTTACCGTGCTGGTGGTGGGCTTCCCGGCCAACTGCCTGTCCCTCTACTTCGGCTACCTGCAGATCAAGGCCCGGAACGAGCTGGGCGTGTACCTGTGCAACCTGACGGTGGCCGACCTCTTCTACATCTGCTCGCTGCCCTTCTGGCTGCAGTACGTGCTGCAGCACGACAACTGGTCTCACGGCGACCTGTCCTGCCAGGTGTGCGGCATCCTCCTGTACGAGAACATCTACATCAGCGTGGGCTTCCTCTGCTGCATCTCCGTGGACCGCTACCTGGCTGTGGCCCATCCCTTCCGCTTCCACCAGTTCCGGACCCTGAAGGCGGCCGTCGGCGTCAGCGTGGTCATCTGGGCCAAGGAGCTGCTGACCAGCATCTACTTCCTGATGCACGAGGAGGTCATCGAGGACGAGAACCAGCACCGCGTGTGCTTTGAGCACTACCCCATCCAGGCATGGCAGCGCGCCATCAACTACTACCGCTTCCTGGTGGGCTTCCTCTTCCCCATCTGCCTGCTGCTGGCGTCCTACCAGGGCATCCTGCGCGCCGTGCGCCGGAGCCACGGCACCCAGAAGAGCCGCAAGGACCAGATCCAGCGGCTGGTGCTCAGCACCGTGGTCATCTTCCTGGCCTGCTTCCTGCCCTACCACGTGTTGCTGCTGGTGCGCAGCGTCTGGGAGGCCAGCTGCGACTTCGCCAAGGGCGTTTTCAACGCCTACCACTTCTCCCTCCTGCTCACCAGCTTCAACTGCGTCGCCGACCCCGTGCTCTACTGCTTCGTCAGCGAGACCACCCACCGGGACCTGGCCCGCCTCCGCGGGGCCTGCCTGGCCTTCCTCACCTGCTCCAGGACCGGCCGGGCCAGGGAGGCCTACCCGCTGGGTGCCCCCGAGGCCTCCGGGAAAAGCGGGGCCCAGGGTGAGGAGCCCGAGCTGTTGACCAAGCTCCACCCGGCCTTCCAGACCCCTAACTCGCCAGGGTCGGGCGGGTTCCCCACGGGCAGGTTGGCCTAG
ORF Protein Sequence MGNITADNSSMSCTIDHTIHQTLAPVVYVTVLVVGFPANCLSLYFGYLQIKARNELGVYLCNLTVADLFYICSLPFWLQYVLQHDNWSHGDLSCQVCGILLYENIYISVGFLCCISVDRYLAVAHPFRFHQFRTLKAAVGVSVVIWAKELLTSIYFLMHEEVIEDENQHRVCFEHYPIQAWQRAINYYRFLVGFLFPICLLLASYQGILRAVRRSHGTQKSRKDQIQRLVLSTVVIFLACFLPYHVLLLVRSVWEASCDFAKGVFNAYHFSLLLTSFNCVADPVLYCFVSETTHRDLARLRGACLAFLTCSRTGRAREAYPLGAPEASGKSGAQGEEPELLTKLHPAFQTPNSPGSGGFPTGRLA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0544-Ab Anti-OGR1/ GPR68/ AI2A6 monoclonal antibody
    Target Antigen GM-Tg-g-MP0544-Ag GPR68 VLP (virus-like particle)
    ORF Viral Vector pGMLP004182 Human GPR68 Lentivirus plasmid
    ORF Viral Vector vGMLP004182 Human GPR68 Lentivirus particle


    Target information

    Target ID GM-MP0544
    Target Name GPR68
    Gene ID 8111, 238377, 696529, 314386, 101095587, 100688992, 281799, 100053071
    Gene Symbol and Synonyms AI2A6,GPR12A,GPR68,OGR1
    Uniprot Accession Q15743
    Uniprot Entry Name OGR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000119714
    Target Classification Not Available

    The protein encoded by this gene is a G protein-coupled receptor for sphingosylphosphorylcholine. The encoded protein is a proton-sensing receptor, inactive at pH 7.8 but active at pH 6.8. Mutations in this gene are a cause of amelogenesis imperfecta. [provided by RefSeq, Feb 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.