Human RNF114/PSORS12/ZNF313 ORF/cDNA clone-Lentivirus plasmid (NM_018683)

Cat. No.: pGMLP004290
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RNF114/PSORS12/ZNF313 Lentiviral expression plasmid for RNF114 lentivirus packaging, RNF114 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RNF114/PSORS12 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $471.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004290
Gene Name RNF114
Accession Number NM_018683
Gene ID 55905
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 687 bp
Gene Alias PSORS12,ZNF313
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGCAACAGCGGGACTGCGGGGGTGCTGCGCAGCTGGCGGGGCCGGCGGCGGAGGCTGACCCCCTAGGACGCTTCACGTGTCCCGTGTGCTTAGAGGTGTACGAGAAGCCGGTACAGGTGCCCTGCGGACACGTCTTTTGCTCTGCATGCCTGCAGGAATGTCTGAAGCCGAAGAAGCCTGTCTGTGGGGTGTGTCGCAGCGCTCTGGCACCTGGCGTCCGAGCCGTGGAGCTCGAGCGGCAGATCGAGAGCACAGAGACTTCTTGCCATGGCTGCCGTAAGAATTTCTTCCTGTCCAAGATCCGGTCCCACGTGGCTACTTGTTCCAAATACCAGAATTACATCATGGAAGGTGTGAAGGCCACCATTAAGGATGCATCTCTTCAGCCAAGGAATGTTCCAAACCGTTACACCTTTCCTTGTCCTTACTGTCCTGAGAAGAACTTTGATCAGGAAGGACTTGTGGAACACTGCAAATTATTCCATAGCACGGATACCAAATCTGTGGTTTGTCCGATATGTGCCTCGATGCCCTGGGGAGACCCCAACTACCGCAGCGCCAACTTCAGAGAGCACATCCAGCGCCGGCACCGGTTTTCTTATGACACTTTTGTGGATTATGATGTTGATGAAGAGGACATGATGAATCAGGTGTTGCAGCGCTCCATCATCGACCAGTGA
ORF Protein Sequence MAAQQRDCGGAAQLAGPAAEADPLGRFTCPVCLEVYEKPVQVPCGHVFCSACLQECLKPKKPVCGVCRSALAPGVRAVELERQIESTETSCHGCRKNFFLSKIRSHVATCSKYQNYIMEGVKATIKDASLQPRNVPNRYTFPCPYCPEKNFDQEGLVEHCKLFHSTDTKSVVCPICASMPWGDPNYRSANFREHIQRRHRFSYDTFVDYDVDEEDMMNQVLQRSIIDQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2305-Ab Anti-RN114/ RNF114/ PSORS12 monoclonal antibody
    Target Antigen GM-Tg-g-MP2305-Ag RNF114 VLP (virus-like particle)
    ORF Viral Vector pGMLP004290 Human RNF114 Lentivirus plasmid
    ORF Viral Vector vGMLP004290 Human RNF114 Lentivirus particle


    Target information

    Target ID GM-MP2305
    Target Name RNF114
    Gene ID 55905, 81018, 713517, 362277, 101101045, 477261, 513479, 100071447
    Gene Symbol and Synonyms 1110008J21Rik,PSORS12,RNF114,Zfp228,Zfp313,Znf228,ZNF313
    Uniprot Accession Q9Y508
    Uniprot Entry Name RN114_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000124226
    Target Classification Not Available

    Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in protein polyubiquitination and ubiquitin-dependent protein catabolic process. Located in cytosol and plasma membrane. Biomarker of male infertility. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.