Human GPA33/A33 ORF/cDNA clone-Lentivirus plasmid (NM_005814)

Cat. No.: pGMLP004352
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPA33/A33 Lentiviral expression plasmid for GPA33 lentivirus packaging, GPA33 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GPA33/A33 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $540
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004352
Gene Name GPA33
Accession Number NM_005814
Gene ID 10223
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 960 bp
Gene Alias A33
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGGGAAGATGTGGCCTGTGTTGTGGACACTCTGTGCAGTCAGGGTGACCGTCGATGCCATCTCTGTGGAAACTCCGCAGGACGTTCTTCGGGCTTCGCAGGGAAAGAGTGTCACCCTGCCCTGCACCTACCACACTTCCACCTCCAGTCGAGAGGGACTTATTCAATGGGATAAGCTCCTCCTCACTCATACGGAAAGGGTGGTCATCTGGCCGTTTTCAAACAAAAACTACATCCATGGTGAGCTTTATAAGAATCGCGTCAGCATATCCAACAATGCTGAGCAGTCCGATGCCTCCATCACCATTGATCAGCTGACCATGGCTGACAACGGCACCTACGAGTGTTCTGTCTCGCTGATGTCAGACCTGGAGGGCAACACCAAGTCACGTGTCCGCCTGTTGGTCCTCGTGCCACCCTCCAAACCAGAATGCGGCATCGAGGGAGAGACCATAATTGGGAACAACATCCAGCTGACCTGCCAATCAAAGGAGGGCTCACCAACCCCTCAGTACAGCTGGAAGAGGTACAACATCCTGAATCAGGAGCAGCCCCTGGCCCAGCCAGCCTCAGGTCAGCCTGTCTCCCTGAAGAATATCTCCACAGACACATCGGGTTACTACATCTGTACCTCCAGCAATGAGGAGGGGACGCAGTTCTGCAACATCACGGTGGCCGTCAGATCTCCCTCCATGAACGTGGCCCTGTATGTGGGCATCGCGGTGGGCGTGGTTGCAGCCCTCATTATCATTGGCATCATCATCTACTGCTGCTGCTGCCGAGGGAAGGACGACAACACTGAAGACAAGGAGGATGCAAGGCCGAACCGGGAAGCCTATGAGGAGCCACCAGAGCAGCTAAGAGAACTTTCCAGAGAGAGGGAGGAGGAGGATGACTACAGGCAAGAAGAGCAGAGGAGCACTGGGCGTGAATCCCCGGACCACCTCGACCAGTGA
ORF Protein Sequence MVGKMWPVLWTLCAVRVTVDAISVETPQDVLRASQGKSVTLPCTYHTSTSSREGLIQWDKLLLTHTERVVIWPFSNKNYIHGELYKNRVSISNNAEQSDASITIDQLTMADNGTYECSVSLMSDLEGNTKSRVRLLVLVPPSKPECGIEGETIIGNNIQLTCQSKEGSPTPQYSWKRYNILNQEQPLAQPASGQPVSLKNISTDTSGYYICTSSNEEGTQFCNITVAVRSPSMNVALYVGIAVGVVAALIIIGIIIYCCCCRGKDDNTEDKEDARPNREAYEEPPEQLRELSREREEEDDYRQEEQRSTGRESPDHLDQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57001-Ab Anti-GPA33/ A33 monoclonal antibody
    Target Antigen GM-Tg-g-T57001-Ag GPA33 VLP (virus-like particle)
    ORF Viral Vector pGMLP004352 Human GPA33 Lentivirus plasmid
    ORF Viral Vector vGMLP004352 Human GPA33 Lentivirus particle


    Target information

    Target ID GM-T57001
    Target Name GPA33
    Gene ID 10223, 59290, 697421, 360873, 101101533, 611598, 518646, 100056610
    Gene Symbol and Synonyms 2010310L10Rik,2210401D16Rik,A33,GPA33,mA33
    Uniprot Accession Q99795
    Uniprot Entry Name GPA33_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000143167
    Target Classification Checkpoint-Immuno Oncology

    The glycoprotein encoded by this gene is a cell surface antigen that is expressed in greater than 95% of human colon cancers. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. The sequence of the extracellular region contains 2 domains characteristic of the CD2 subgroup of the immunoglobulin (Ig) superfamily. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.