Human GPA33/A33 ORF/cDNA clone-Lentivirus plasmid (NM_005814)
Cat. No.: pGMLP004352
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GPA33/A33 Lentiviral expression plasmid for GPA33 lentivirus packaging, GPA33 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GPA33/A33 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004352 |
Gene Name | GPA33 |
Accession Number | NM_005814 |
Gene ID | 10223 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 960 bp |
Gene Alias | A33 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGTGGGGAAGATGTGGCCTGTGTTGTGGACACTCTGTGCAGTCAGGGTGACCGTCGATGCCATCTCTGTGGAAACTCCGCAGGACGTTCTTCGGGCTTCGCAGGGAAAGAGTGTCACCCTGCCCTGCACCTACCACACTTCCACCTCCAGTCGAGAGGGACTTATTCAATGGGATAAGCTCCTCCTCACTCATACGGAAAGGGTGGTCATCTGGCCGTTTTCAAACAAAAACTACATCCATGGTGAGCTTTATAAGAATCGCGTCAGCATATCCAACAATGCTGAGCAGTCCGATGCCTCCATCACCATTGATCAGCTGACCATGGCTGACAACGGCACCTACGAGTGTTCTGTCTCGCTGATGTCAGACCTGGAGGGCAACACCAAGTCACGTGTCCGCCTGTTGGTCCTCGTGCCACCCTCCAAACCAGAATGCGGCATCGAGGGAGAGACCATAATTGGGAACAACATCCAGCTGACCTGCCAATCAAAGGAGGGCTCACCAACCCCTCAGTACAGCTGGAAGAGGTACAACATCCTGAATCAGGAGCAGCCCCTGGCCCAGCCAGCCTCAGGTCAGCCTGTCTCCCTGAAGAATATCTCCACAGACACATCGGGTTACTACATCTGTACCTCCAGCAATGAGGAGGGGACGCAGTTCTGCAACATCACGGTGGCCGTCAGATCTCCCTCCATGAACGTGGCCCTGTATGTGGGCATCGCGGTGGGCGTGGTTGCAGCCCTCATTATCATTGGCATCATCATCTACTGCTGCTGCTGCCGAGGGAAGGACGACAACACTGAAGACAAGGAGGATGCAAGGCCGAACCGGGAAGCCTATGAGGAGCCACCAGAGCAGCTAAGAGAACTTTCCAGAGAGAGGGAGGAGGAGGATGACTACAGGCAAGAAGAGCAGAGGAGCACTGGGCGTGAATCCCCGGACCACCTCGACCAGTGA |
ORF Protein Sequence | MVGKMWPVLWTLCAVRVTVDAISVETPQDVLRASQGKSVTLPCTYHTSTSSREGLIQWDKLLLTHTERVVIWPFSNKNYIHGELYKNRVSISNNAEQSDASITIDQLTMADNGTYECSVSLMSDLEGNTKSRVRLLVLVPPSKPECGIEGETIIGNNIQLTCQSKEGSPTPQYSWKRYNILNQEQPLAQPASGQPVSLKNISTDTSGYYICTSSNEEGTQFCNITVAVRSPSMNVALYVGIAVGVVAALIIIGIIIYCCCCRGKDDNTEDKEDARPNREAYEEPPEQLRELSREREEEDDYRQEEQRSTGRESPDHLDQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T57001-Ab | Anti-GPA33/ A33 monoclonal antibody |
Target Antigen | GM-Tg-g-T57001-Ag | GPA33 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004352 | Human GPA33 Lentivirus plasmid |
ORF Viral Vector | vGMLP004352 | Human GPA33 Lentivirus particle |
Target information
Target ID | GM-T57001 |
Target Name | GPA33 |
Gene ID | 10223, 59290, 697421, 360873, 101101533, 611598, 518646, 100056610 |
Gene Symbol and Synonyms | 2010310L10Rik,2210401D16Rik,A33,GPA33,mA33 |
Uniprot Accession | Q99795 |
Uniprot Entry Name | GPA33_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000143167 |
Target Classification | Checkpoint-Immuno Oncology |
The glycoprotein encoded by this gene is a cell surface antigen that is expressed in greater than 95% of human colon cancers. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. The sequence of the extracellular region contains 2 domains characteristic of the CD2 subgroup of the immunoglobulin (Ig) superfamily. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.