Human CREG1/CREG ORF/cDNA clone-Lentivirus plasmid (NM_003851)
Cat. No.: pGMLP004358
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CREG1/CREG Lentiviral expression plasmid for CREG1 lentivirus packaging, CREG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CREG1/CREG products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004358 |
Gene Name | CREG1 |
Accession Number | NM_003851 |
Gene ID | 8804 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 663 bp |
Gene Alias | CREG |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACTGCTCGCCGCCCTGCTGGCGTCGACGCTGTTGGCGCTGCTCGTGTCGCCCGCGCGGGGTCGCGGCGGCCGGGACCACGGGGACTGGGACGAGGCCTCCCGGCTGCCGCCGCTACCACCCCGCGAGGACGCGGCGCGCGTGGCCCGCTTCGTGACGCACGTCTCCGACTGGGGCGCTCTGGCCACCATCTCCACGCTGGAGGCGGTGCGCGGCCGGCCCTTCGCCGACGTCCTCTCGCTCAGCGACGGGCCCCCGGGCGCGGGCAGCGGCGTGCCCTATTTCTACCTGAGCCCGCTGCAGCTCTCCGTGAGCAACCTGCAGGAGAATCCATATGCTACACTGACCATGACTTTGGCACAGACCAACTTCTGCAAGAAACATGGATTTGATCCACAAAGTCCCCTTTGTGTTCACATAATGCTGTCAGGAACTGTGACCAAGGTGAATGAAACAGAAATGGATATTGCAAAGCATTCGTTATTCATTCGACACCCTGAGATGAAAACCTGGCCTTCCAGCCATAATTGGTTCTTTGCTAAGTTGAATATAACCAATATCTGGGTCCTGGACTACTTTGGTGGACCAAAAATCGTGACACCAGAAGAATATTATAATGTCACAGTTCAGTGA |
ORF Protein Sequence | MAGLSRGSARALLAALLASTLLALLVSPARGRGGRDHGDWDEASRLPPLPPREDAARVARFVTHVSDWGALATISTLEAVRGRPFADVLSLSDGPPGAGSGVPYFYLSPLQLSVSNLQENPYATLTMTLAQTNFCKKHGFDPQSPLCVHIMLSGTVTKVNETEMDIAKHSLFIRHPEMKTWPSSHNWFFAKLNITNIWVLDYFGGPKIVTPEEYYNVTVQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0122-Ab | Anti-CREG1/ CREG functional antibody |
Target Antigen | GM-Tg-g-SE0122-Ag | CREG1 protein |
ORF Viral Vector | pGMLP004358 | Human CREG1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004358 | Human CREG1 Lentivirus particle |
Target information
Target ID | GM-SE0122 |
Target Name | CREG1 |
Gene ID | 8804, 433375, 701021, 289185, 101098599, 100686738, 530908, 100056817 |
Gene Symbol and Synonyms | CREG,CREG1 |
Uniprot Accession | O75629 |
Uniprot Entry Name | CREG1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000143162 |
Target Classification | Not Available |
The adenovirus E1A protein both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. The protein encoded by this gene antagonizes transcriptional activation and cellular transformation by E1A. This protein shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. This gene may contribute to the transcriptional control of cell growth and differentiation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.