Human GPR4 ORF/cDNA clone-Lentivirus plasmid (NM_005282)

Cat. No.: pGMLP004388
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPR4/ Lentiviral expression plasmid for GPR4 lentivirus packaging, GPR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GPR4/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $604.92
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004388
Gene Name GPR4
Accession Number NM_005282
Gene ID 2828
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1089 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCAACCACACGTGGGAGGGCTGCCACGTGGACTCGCGCGTGGACCACCTCTTTCCGCCATCCCTCTACATCTTTGTCATCGGCGTGGGGCTGCCCACCAACTGCCTGGCTCTGTGGGCGGCCTACCGCCAGGTGCAACAGCGCAACGAGCTGGGCGTCTACCTGATGAACCTCAGCATCGCCGACCTGCTGTACATCTGCACGCTGCCGCTGTGGGTGGACTACTTCCTGCACCACGACAACTGGATCCACGGCCCCGGGTCCTGCAAGCTCTTTGGGTTCATCTTCTACACCAATATCTACATCAGCATCGCCTTCCTGTGCTGCATCTCGGTGGACCGCTACCTGGCTGTGGCCCACCCACTCCGCTTCGCCCGCCTGCGCCGCGTCAAGACCGCCGTGGCCGTGAGCTCCGTGGTCTGGGCCACGGAGCTGGGCGCCAACTCGGCGCCCCTGTTCCATGACGAGCTCTTCCGAGACCGCTACAACCACACCTTCTGCTTTGAGAAGTTCCCCATGGAAGGCTGGGTGGCCTGGATGAACCTCTATCGGGTGTTCGTGGGCTTCCTCTTCCCGTGGGCGCTCATGCTGCTGTCGTACCGGGGCATCCTGCGGGCCGTGCGGGGCAGCGTGTCCACCGAGCGCCAGGAGAAGGCCAAGATCAAGCGGCTGGCCCTCAGCCTCATCGCCATCGTGCTGGTCTGCTTTGCGCCCTATCACGTGCTCTTGCTGTCCCGCAGCGCCATCTACCTGGGCCGCCCCTGGGACTGCGGCTTCGAGGAGCGCGTCTTTTCTGCATACCACAGCTCACTGGCTTTCACCAGCCTCAACTGTGTGGCGGACCCCATCCTCTACTGCCTGGTCAACGAGGGCGCCCGCAGCGATGTGGCCAAGGCCCTGCACAACCTGCTCCGCTTTCTGGCCAGCGACAAGCCCCAGGAGATGGCCAATGCCTCGCTCACCCTGGAGACCCCACTCACCTCCAAGAGGAACAGCACAGCCAAAGCCATGACTGGCAGCTGGGCGGCCACTCCGCCCTCCCAGGGGGACCAGGTGCAGCTGAAGATGCTGCCGCCAGCACAATGA
ORF Protein Sequence MGNHTWEGCHVDSRVDHLFPPSLYIFVIGVGLPTNCLALWAAYRQVQQRNELGVYLMNLSIADLLYICTLPLWVDYFLHHDNWIHGPGSCKLFGFIFYTNIYISIAFLCCISVDRYLAVAHPLRFARLRRVKTAVAVSSVVWATELGANSAPLFHDELFRDRYNHTFCFEKFPMEGWVAWMNLYRVFVGFLFPWALMLLSYRGILRAVRGSVSTERQEKAKIKRLALSLIAIVLVCFAPYHVLLLSRSAIYLGRPWDCGFEERVFSAYHSSLAFTSLNCVADPILYCLVNEGARSDVAKALHNLLRFLASDKPQEMANASLTLETPLTSKRNSTAKAMTGSWAATPPSQGDQVQLKMLPPAQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0535-Ab Anti-GPR4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0535-Ag GPR4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004388 Human GPR4 Lentivirus plasmid
    ORF Viral Vector vGMLP004388 Human GPR4 Lentivirus particle


    Target information

    Target ID GM-MP0535
    Target Name GPR4
    Gene ID 2828, 319197, 716148, 308408, 111558056, 484440, 512876, 102148705
    Gene Symbol and Synonyms GPR4,GPR6C.l
    Uniprot Accession P46093
    Uniprot Entry Name GPR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000177464
    Target Classification GPCR

    Enables G protein-coupled receptor activity. Involved in several processes, including G protein-coupled receptor signaling pathway; positive regulation of Rho protein signal transduction; and response to acidic pH. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.