Human LAT2/HSPC046/LAB ORF/cDNA clone-Lentivirus plasmid (NM_014146)

Cat. No.: pGMLP004434
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LAT2/HSPC046/LAB Lentiviral expression plasmid for LAT2 lentivirus packaging, LAT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LAT2/HSPC046 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $483
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004434
Gene Name LAT2
Accession Number NM_014146
Gene ID 7462
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 732 bp
Gene Alias HSPC046,LAB,NTAL,WBSCR15,WBSCR5,WSCR5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCGGGGACTGAACTGCTGTGGCCCGGAGCAGCGCTGCTGGTGCTGTTGGGGGTGGCAGCCAGTCTGTGTGTGCGCTGCTCACGCCCAGGTGCAAAGAGGTCAGAGAAAATCTACCAGCAGAGAAGTCTGCGTGAGGACCAACAGAGCTTTACGGGGTCCCGGACCTACTCCTTGGTCGGGCAGGCATGGCCAGGACCCCTGGCGGACATGGCACCCACAAGGAAGGACAAGCTGTTGCAATTCTACCCCAGCCTGGAGGATCCAGCATCTTCCAGGTACCAGAACTTCAGCAAAGGAAGCAGACACGGGTCGGAGGAAGCCTACATAGACCCCATTGCCATGGAGTATTACAACTGGGGGCGGTTCTCGAAGCCCCCAGAAGATGATGATGCCAATTCCTACGAGAATGTGCTCATTTGCAAGCAGAAAACCACAGAGACAGGTGCCCAGCAGGAGGGCATAGGTGGCCTCTGCAGAGGGGACCTCAGCCTGTCACTGGCCCTGAAGACTGGCCCCACTTCTGGTCTCTGTCCCTCTGCCTCCCCGGAAGAAGATGAGGAATCTGAGGATTATCAGAACTCAGCATCCATCCATCAGTGGCGCGAGTCCAGGAAGGTCATGGGGCAACTCCAGAGAGAAGCATCCCCTGGCCCGGTGGGAAGCCCAGACGAGGAGGACGGGGAACCGGATTACGTGAATGGGGAGGTGGCAGCCACAGAAGCCTAG
ORF Protein Sequence MSSGTELLWPGAALLVLLGVAASLCVRCSRPGAKRSEKIYQQRSLREDQQSFTGSRTYSLVGQAWPGPLADMAPTRKDKLLQFYPSLEDPASSRYQNFSKGSRHGSEEAYIDPIAMEYYNWGRFSKPPEDDDANSYENVLICKQKTTETGAQQEGIGGLCRGDLSLSLALKTGPTSGLCPSASPEEDEESEDYQNSASIHQWRESRKVMGQLQREASPGPVGSPDEEDGEPDYVNGEVAATEA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0723-Ab Anti-NTAL/ LAT2/ HSPC046 monoclonal antibody
    Target Antigen GM-Tg-g-MP0723-Ag LAT2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004434 Human LAT2 Lentivirus plasmid
    ORF Viral Vector vGMLP004434 Human LAT2 Lentivirus particle


    Target information

    Target ID GM-MP0723
    Target Name LAT2
    Gene ID 7462, 56743, 693676, 317676, 101098351, 102156541, 505016, 100062168
    Gene Symbol and Synonyms HSPC046,LAB,LAT2,NTAL,WBSCR15,WBSCR5,WSCR5
    Uniprot Accession Q9GZY6
    Uniprot Entry Name NTAL_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000086730
    Target Classification Not Available

    This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.