Human LAPTM4B/LAPTM4beta/LC27 ORF/cDNA clone-Lentivirus plasmid (NM_018407)

Cat. No.: pGMLP004462
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LAPTM4B/LAPTM4beta/LC27 Lentiviral expression plasmid for LAPTM4B lentivirus packaging, LAPTM4B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to LAPTM4B/LAPTM4beta products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $538.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004462
Gene Name LAPTM4B
Accession Number NM_018407
Gene ID 55353
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 954 bp
Gene Alias LAPTM4beta,LC27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGATGGTCGCGCCCTGGACGCGGTTCTACTCCAACAGCTGCTGCTTGTGCTGCCATGTCCGCACCGGCACCATCCTGCTCGGCGTCTGGTATCTGATCATCAATGCTGTGGTACTGTTGATTTTATTGAGTGCCCTGGCTGATCCGGATCAGTATAACTTTTCAAGTTCTGAACTGGGAGGTGACTTTGAGTTCATGGATGATGCCAACATGTGCATTGCCATTGCGATTTCTCTTCTCATGATCCTGATATGTGCTATGGCTACTTACGGAGCGTACAAGCAACGCGCAGCCTGGATCATCCCATTCTTCTGTTACCAGATCTTTGACTTTGCCCTGAACATGTTGGTTGCAATCACTGTGCTTATTTATCCAAACTCCATTCAGGAATACATACGGCAACTGCCTCCTAATTTTCCCTACAGAGATGATGTCATGTCAGTGAATCCTACCTGTTTGGTCCTTATTATTCTTCTGTTTATTAGCATTATCTTGACTTTTAAGGGTTACTTGATTAGCTGTGTTTGGAACTGCTACCGATACATCAATGGTAGGAACTCCTCTGATGTCCTGGTTTATGTTACCAGCAATGACACTACGGTGCTGCTACCCCCGTATGATGATGCCACTGTGAATGGTGCTGCCAAGGAGCCACCGCCACCTTACGTGTCTGCCTAA
ORF Protein Sequence MKMVAPWTRFYSNSCCLCCHVRTGTILLGVWYLIINAVVLLILLSALADPDQYNFSSSELGGDFEFMDDANMCIAIAISLLMILICAMATYGAYKQRAAWIIPFFCYQIFDFALNMLVAITVLIYPNSIQEYIRQLPPNFPYRDDVMSVNPTCLVLIILLFISIILTFKGYLISCVWNCYRYINGRNSSDVLVYVTSNDTTVLLPPYDDATVNGAAKEPPPPYVSA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T31603-Ab Anti-LAP4B/ LAPTM4B/ LAPTM4beta monoclonal antibody
    Target Antigen GM-Tg-g-T31603-Ag LAPTM4B VLP (virus-like particle)
    ORF Viral Vector pGMLP004462 Human LAPTM4B Lentivirus plasmid
    ORF Viral Vector vGMLP004462 Human LAPTM4B Lentivirus particle


    Target information

    Target ID GM-T31603
    Target Name LAPTM4B
    Gene ID 55353, 114128, 702648, 315047, 101095227, 475042, 404155, 100059945
    Gene Symbol and Synonyms C330023P13Rik,LAPTM4B,LAPTM4beta,LC27
    Uniprot Accession Q86VI4
    Uniprot Entry Name LAP4B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000104341
    Target Classification Not Available

    Enables ceramide binding activity; enzyme binding activity; and phosphatidylinositol bisphosphate binding activity. Involved in several processes, including negative regulation of macromolecule metabolic process; regulation of lysosomal membrane permeability; and regulation of lysosome organization. Located in several cellular components, including endosome; lysosomal membrane; and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.