Human CLEC4C/BDCA2/CD303 ORF/cDNA clone-Lentivirus plasmid (NM_130441)

Cat. No.: pGMLP004478
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLEC4C/BDCA2/CD303 Lentiviral expression plasmid for CLEC4C lentivirus packaging, CLEC4C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CLEC4C/BDCA2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $460.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004478
Gene Name CLEC4C
Accession Number NM_130441
Gene ID 170482
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 642 bp
Gene Alias BDCA2,CD303,CLECSF11,CLECSF7,DLEC,HECL,PRO34150
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGCCTGAAGAAGAGCCTCAAGACCGAGAGAAAGGACTCTGGTGGTTCCAGTTGAAGGTCTGGTCCATGGCAGTCGTATCCATCTTGCTCCTCAGTGTCTGTTTCACTGTGAGTTCTGTGGTGCCTCACAATTTTATGTATAGCAAAACTGTCAAGAGGCTGTCCAAGTTACGAGAGTATCAACAGTATCATCCAAGCCTGACCTGCGTCATGGAAGGAAAGGACATAGAAGATTGGAGCTGCTGCCCAACCCCTTGGACTTCATTTCAGTCTAGTTGCTACTTTATTTCTACTGGGATGCAATCTTGGACTAAGAGTCAAAAGAACTGTTCTGTGATGGGGGCTGATCTGGTGGTGATCAACACCAGGGAAGAACAGGATTTCATCATTCAGAATCTGAAAAGAAATTCTTCTTATTTTCTGGGGCTGTCAGATCCAGGGGGTCGGCGACATTGGCAATGGGTTGACCAGACACCATACAATGAAAATGTCACATTCTGGCACTCAGGTGAACCCAATAACCTTGATGAGCGTTGTGCGATAATAAATTTCCGTTCTTCAGAAGAATGGGGCTGGAATGACATTCACTGTCATGTACCTCAGAAGTCAATTTGCAAGATGAAGAAGATCTACATATAA
ORF Protein Sequence MVPEEEPQDREKGLWWFQLKVWSMAVVSILLLSVCFTVSSVVPHNFMYSKTVKRLSKLREYQQYHPSLTCVMEGKDIEDWSCCPTPWTSFQSSCYFISTGMQSWTKSQKNCSVMGADLVVINTREEQDFIIQNLKRNSSYFLGLSDPGGRRHWQWVDQTPYNENVTFWHSGEPNNLDERCAIINFRSSEEWGWNDIHCHVPQKSICKMKKIYI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0296-Ab Anti-CLC4C/ CLEC4C/ BDCA2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0296-Ag CLEC4C VLP (virus-like particle)
    ORF Viral Vector pGMLP004478 Human CLEC4C Lentivirus plasmid
    ORF Viral Vector vGMLP004478 Human CLEC4C Lentivirus particle


    Target information

    Target ID GM-MP0296
    Target Name CLEC4C
    Gene ID 170482, 100424643
    Gene Symbol and Synonyms BDCA-2,BDCA2,CD303,CLEC4C,CLECSF11,CLECSF7,DLEC,HECL,PRO34150
    Uniprot Accession Q8WTT0
    Uniprot Entry Name CLC4C_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000198178
    Target Classification Not Available

    This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.