Human PF4/CXCL4/ PF-4 ORF/cDNA clone-Lentivirus plasmid (NM_002619)

Pre-made Human PF4/CXCL4/ PF-4 Lentiviral expression plasmid for PF4 lentivirus packaging, PF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PF4/CXCL4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004508 Human PF4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004508
Gene Name PF4
Accession Number NM_002619
Gene ID 5196
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 306 bp
Gene Alias CXCL4, PF-4, SCYB4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCTCCGCAGCCGGGTTCTGCGCCTCACGCCCCGGGCTGCTGTTCCTGGGGTTGCTGCTCCTGCCACTTGTGGTCGCCTTCGCCAGCGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGTGTGAAGACCACCTCCCAGGTCCGTCCCAGGCACATCACCAGCCTGGAGGTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTGATAGCCACGCTGAAGAATGGAAGGAAAATTTGCTTGGACCTGCAAGCCCCGCTGTACAAGAAAATAATTAAGAAACTTTTGGAGAGTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30827-Ab Anti-PLF4/ PF4/ CXCL4 functional antibody
    Target Antigen GM-Tg-g-T30827-Ag PF4 protein
    Cytokine cks-Tg-g-GM-T30827 platelet factor 4 (PF4) protein & antibody
    ORF Viral Vector pGMLP004508 Human PF4 Lentivirus plasmid
    ORF Viral Vector vGMLP004508 Human PF4 Lentivirus particle


    Target information

    Target ID GM-T30827
    Target Name PF4
    Gene ID 5196, 56744, 703451, 360918, 507790, 100630489
    Gene Symbol and Synonyms CXCL4,LOC100630489,PF-4,PF4,Pf4a,RATPF4A,SCYB4
    Uniprot Accession P02776
    Uniprot Entry Name PLF4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer
    Gene Ensembl ENSG00000163737
    Target Classification Not Available

    This gene encodes a member of the CXC chemokine family. This chemokine is released from the alpha granules of activated platelets in the form of a homotetramer which has high affinity for heparin and is involved in platelet aggregation. This protein is chemotactic for numerous other cell type and also functions as an inhibitor of hematopoiesis, angiogenesis and T-cell function. The protein also exhibits antimicrobial activity against Plasmodium falciparum. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.