Human PF4/CXCL4/ PF-4 ORF/cDNA clone-Lentivirus plasmid (NM_002619)
Pre-made Human PF4/CXCL4/ PF-4 Lentiviral expression plasmid for PF4 lentivirus packaging, PF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PF4/CXCL4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004508 | Human PF4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004508 |
Gene Name | PF4 |
Accession Number | NM_002619 |
Gene ID | 5196 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 306 bp |
Gene Alias | CXCL4, PF-4, SCYB4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCTCCGCAGCCGGGTTCTGCGCCTCACGCCCCGGGCTGCTGTTCCTGGGGTTGCTGCTCCTGCCACTTGTGGTCGCCTTCGCCAGCGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGTGTGAAGACCACCTCCCAGGTCCGTCCCAGGCACATCACCAGCCTGGAGGTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTGATAGCCACGCTGAAGAATGGAAGGAAAATTTGCTTGGACCTGCAAGCCCCGCTGTACAAGAAAATAATTAAGAAACTTTTGGAGAGTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T30827-Ab | Anti-PLF4/ PF4/ CXCL4 functional antibody |
Target Antigen | GM-Tg-g-T30827-Ag | PF4 protein |
Cytokine | cks-Tg-g-GM-T30827 | platelet factor 4 (PF4) protein & antibody |
ORF Viral Vector | pGMLP004508 | Human PF4 Lentivirus plasmid |
ORF Viral Vector | vGMLP004508 | Human PF4 Lentivirus particle |
Target information
Target ID | GM-T30827 |
Target Name | PF4 |
Gene ID | 5196, 56744, 703451, 360918, 507790, 100630489 |
Gene Symbol and Synonyms | CXCL4,LOC100630489,PF-4,PF4,Pf4a,RATPF4A,SCYB4 |
Uniprot Accession | P02776 |
Uniprot Entry Name | PLF4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | cancer |
Gene Ensembl | ENSG00000163737 |
Target Classification | Not Available |
This gene encodes a member of the CXC chemokine family. This chemokine is released from the alpha granules of activated platelets in the form of a homotetramer which has high affinity for heparin and is involved in platelet aggregation. This protein is chemotactic for numerous other cell type and also functions as an inhibitor of hematopoiesis, angiogenesis and T-cell function. The protein also exhibits antimicrobial activity against Plasmodium falciparum. [provided by RefSeq, Oct 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.