Human SCGB3A1/HIN-1/ HIN1 ORF/cDNA clone-Lentivirus plasmid (NM_052863)

Pre-made Human SCGB3A1/HIN-1/ HIN1 Lentiviral expression plasmid for SCGB3A1 lentivirus packaging, SCGB3A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SCGB3A1/HIN-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004519 Human SCGB3A1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004519
Gene Name SCGB3A1
Accession Number NM_052863
Gene ID 92304
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 315 bp
Gene Alias HIN-1, HIN1, LU105, PnSP-2, UGRP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCTCGCCGCCCTCCTGGGGCTCTGCGTGGCCCTGTCCTGCAGCTCCGCTGCTGCTTTCTTAGTGGGCTCGGCCAAGCCTGTGGCCCAGCCTGTCGCTGCGCTGGAGTCGGCGGCGGAGGCCGGGGCCGGGACCCTGGCCAACCCCCTCGGCACCCTCAACCCGCTGAAGCTCCTGCTGAGCAGCCTGGGCATCCCCGTGAACCACCTCATAGAGGGCTCCCAGAAGTGTGTGGCTGAGCTGGGTCCCCAGGCCGTGGGGGCCGTGAAGGCCCTGAAGGCCCTGCTGGGGGCCCTGACAGTGTTTGGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1269-Ab Anti-SG3A1/ SCGB3A1/ HIN-1 functional antibody
    Target Antigen GM-Tg-g-SE1269-Ag SCGB3A1 protein
    ORF Viral Vector pGMLP004519 Human SCGB3A1 Lentivirus plasmid
    ORF Viral Vector vGMLP004519 Human SCGB3A1 Lentivirus particle


    Target information

    Target ID GM-SE1269
    Target Name SCGB3A1
    Gene ID 92304, 68662, 716331, 338418, 109492767
    Gene Symbol and Synonyms HIN-1,HIN1,LU105,LuLeu2,PnSP-2,Pnsp2,SCGB3A1,secretoglobin,UGRP2,Utgrp2
    Uniprot Accession Q96QR1
    Uniprot Entry Name SG3A1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000161055
    Target Classification Tumor-associated antigen (TAA)

    Predicted to be involved in positive regulation of myoblast fusion. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.