Human TFF3/ITF/ P1B ORF/cDNA clone-Lentivirus plasmid (NM_003226)

Pre-made Human TFF3/ITF/ P1B Lentiviral expression plasmid for TFF3 lentivirus packaging, TFF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TFF3/ITF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004527 Human TFF3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004527
Gene Name TFF3
Accession Number NM_003226
Gene ID 7033
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 285 bp
Gene Alias ITF, P1B, TFI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCGAGTCCTGAGCTGCGTCCCGGAGCCCACGGTGGTCATGGCTGCCAGAGCGCTCTGCATGCTGGGGCTGGTCCTGGCCTTGCTGTCCTCCAGCTCTGCTGAGGAGTACGTGGGCCTGTCTGCAAACCAGTGTGCCGTGCCAGCCAAGGACAGGGTGGACTGCGGCTACCCCCATGTCACCCCCAAGGAGTGCAACAACCGGGGCTGCTGCTTTGACTCCAGGATCCCTGGAGTGCCTTGGTGTTTCAAGCCCCTGCAGGAAGCAGAATGCACCTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1334-Ab Anti-TFF3/ ITF/ P1B functional antibody
    Target Antigen GM-Tg-g-SE1334-Ag TFF3 protein
    ORF Viral Vector pGMLP004527 Human TFF3 Lentivirus plasmid
    ORF Viral Vector vGMLP004527 Human TFF3 Lentivirus particle
    ORF Viral Vector pGMLV002284 Human TFF3 Lentivirus plasmid


    Target information

    Target ID GM-SE1334
    Target Name TFF3
    Gene ID 7033, 21786, 722463, 25563, 100170655, 403488, 517889, 100058018
    Gene Symbol and Synonyms ITF,mITF,P1B,TFF3,TFI
    Uniprot Accession Q07654
    Uniprot Entry Name TFF3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Prostate Cancer, Kidney failure
    Gene Ensembl ENSG00000160180
    Target Classification Not Available

    Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. This gene is expressed in goblet cells of the intestines and colon. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.