Human TFF3/ITF/ P1B ORF/cDNA clone-Lentivirus plasmid (NM_003226)
Pre-made Human TFF3/ITF/ P1B Lentiviral expression plasmid for TFF3 lentivirus packaging, TFF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TFF3/ITF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004527 | Human TFF3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004527 |
Gene Name | TFF3 |
Accession Number | NM_003226 |
Gene ID | 7033 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 285 bp |
Gene Alias | ITF, P1B, TFI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGCGAGTCCTGAGCTGCGTCCCGGAGCCCACGGTGGTCATGGCTGCCAGAGCGCTCTGCATGCTGGGGCTGGTCCTGGCCTTGCTGTCCTCCAGCTCTGCTGAGGAGTACGTGGGCCTGTCTGCAAACCAGTGTGCCGTGCCAGCCAAGGACAGGGTGGACTGCGGCTACCCCCATGTCACCCCCAAGGAGTGCAACAACCGGGGCTGCTGCTTTGACTCCAGGATCCCTGGAGTGCCTTGGTGTTTCAAGCCCCTGCAGGAAGCAGAATGCACCTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1334-Ab | Anti-TFF3/ ITF/ P1B functional antibody |
Target Antigen | GM-Tg-g-SE1334-Ag | TFF3 protein |
ORF Viral Vector | pGMLP004527 | Human TFF3 Lentivirus plasmid |
ORF Viral Vector | vGMLP004527 | Human TFF3 Lentivirus particle |
ORF Viral Vector | pGMLV002284 | Human TFF3 Lentivirus plasmid |
Target information
Target ID | GM-SE1334 |
Target Name | TFF3 |
Gene ID | 7033, 21786, 722463, 25563, 100170655, 403488, 517889, 100058018 |
Gene Symbol and Synonyms | ITF,mITF,P1B,TFF3,TFI |
Uniprot Accession | Q07654 |
Uniprot Entry Name | TFF3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Prostate Cancer, Kidney failure |
Gene Ensembl | ENSG00000160180 |
Target Classification | Not Available |
Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. This gene is expressed in goblet cells of the intestines and colon. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.