Human DRAM1/DRAM ORF/cDNA clone-Lentivirus plasmid (NM_018370)

Cat. No.: pGMLP004543
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DRAM1/DRAM Lentiviral expression plasmid for DRAM1 lentivirus packaging, DRAM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DRAM1/DRAM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $479.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004543
Gene Name DRAM1
Accession Number NM_018370
Gene ID 55332
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 717 bp
Gene Alias DRAM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGTGCTTCCTGAGGGGAATGGCTTTCGTCCCCTTCCTCTTGGTGACCTGGTCGTCAGCCGCCTTCATTATCTCCTACGTGGTCGCCGTGCTCTCCGGGCACGTCAACCCCTTCCTCCCGTATATCAGTGATACGGGAACAACACCTCCAGAGAGTGGTATTTTTGGATTTATGATAAACTTCTCTGCATTTCTTGGTGCAGCCACGATGTATACAAGATACAAAATAGTACAGAAGCAAAATCAAACCTGCTATTTCAGCACTCCTGTTTTTAACTTGGTGTCTTTAGTGCTTGGATTGGTGGGATGTTTCGGAATGGGCATTGTCGCCAATTTTCAGGAGTTAGCTGTGCCAGTGGTTCATGACGGGGGCGCTCTTTTGGCCTTTGTCTGTGGTGTCGTGTACACGCTCCTACAGTCCATCATCTCTTACAAATCATGTCCCCAGTGGAACAGTCTCTCGACATGCCACATACGGATGGTCATCTCTGCCGTTTCTTGCGCAGCTGTCATCCCCATGATTGTCTGTGCTTCACTAATTTCCATAACCAAGCTGGAGTGGAATCCAAGAGAAAAGGATTATGTATATCACGTAGTGAGTGCGATCTGTGAATGGACAGTGGCCTTTGGTTTTATTTTCTACTTCCTAACTTTCATCCAAGATTTCCAGAGTGTCACCCTAAGGATATCCACAGAAATCAATGGTGATATTTGA
ORF Protein Sequence MLCFLRGMAFVPFLLVTWSSAAFIISYVVAVLSGHVNPFLPYISDTGTTPPESGIFGFMINFSAFLGAATMYTRYKIVQKQNQTCYFSTPVFNLVSLVLGLVGCFGMGIVANFQELAVPVVHDGGALLAFVCGVVYTLLQSIISYKSCPQWNSLSTCHIRMVISAVSCAAVIPMIVCASLISITKLEWNPREKDYVYHVVSAICEWTVAFGFIFYFLTFIQDFQSVTLRISTEINGDI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0728-Ab Anti-DRAM1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0728-Ag DRAM1 protein
    ORF Viral Vector pGMLP004543 Human DRAM1 Lentivirus plasmid
    ORF Viral Vector pGMLP-atg-023 Human DRAM1 Lentivirus plasmid
    ORF Viral Vector pGMAP-atg-077 Human DRAM1 Adenovirus plasmid
    ORF Viral Vector vGMLP004543 Human DRAM1 Lentivirus particle
    ORF Viral Vector vGMLP-atg-023 Human DRAM1 Lentivirus particle
    ORF Viral Vector vGMAP-atg-077 Human DRAM1 Adenovirus particle


    Target information

    Target ID GM-IP0728
    Target Name DRAM1
    Gene ID 55332, 71712, 697427, 679937, 101081234, 612179, 533992, 100067057
    Gene Symbol and Synonyms 1200002N14Rik,DRAM,DRAM1
    Uniprot Accession Q8N682
    Uniprot Entry Name DRAM1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000136048
    Target Classification Not Available

    This gene is regulated as part of the p53 tumor suppressor pathway. The gene encodes a lysosomal membrane protein that is required for the induction of autophagy by the pathway. Decreased transcriptional expression of this gene is associated with various tumors. This gene has a pseudogene on chromosome 4. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.