Human DRAM1/DRAM ORF/cDNA clone-Adenovirus particle (NM_018370)
Cat. No.: vGMAP-atg-077
Pre-made Human DRAM1/DRAM Adenovirus for DRAM1 overexpression in-vitro and in-vivo. The DRAM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DRAM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
DRAM1/DRAM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-atg-077 | Human DRAM1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-atg-077 |
| Gene Name | DRAM1 |
| Accession Number | NM_018370 |
| Gene ID | 55332 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 717 bp |
| Gene Alias | DRAM |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTGTGCTTCCTGAGGGGAATGGCTTTCGTCCCCTTCCTCTTGGTGACCTGGTCGTCAGCCGCCTTCATTATCTCCTACGTGGTCGCCGTGCTCTCCGGGCACGTCAACCCCTTCCTCCCGTATATCAGTGATACGGGAACAACACCTCCAGAGAGTGGTATTTTTGGATTTATGATAAACTTCTCTGCATTTCTTGGTGCAGCCACGATGTATACAAGATACAAAATAGTACAGAAGCAAAATCAAACCTGCTATTTCAGCACTCCTGTTTTTAACTTGGTGTCTTTAGTGCTTGGATTGGTGGGATGTTTCGGAATGGGCATTGTCGCCAATTTTCAGGAGTTAGCTGTGCCAGTGGTTCATGACGGGGGCGCTCTTTTGGCCTTTGTCTGTGGTGTCGTGTACACGCTCCTACAGTCCATCATCTCTTACAAATCATGTCCCCAGTGGAACAGTCTCTCGACATGCCACATACGGATGGTCATCTCTGCCGTTTCTTGCGCAGCTGTCATCCCCATGATTGTCTGTGCTTCACTAATTTCCATAACCAAGCTGGAGTGGAATCCAAGAGAAAAGGATTATGTATATCACGTAGTGAGTGCGATCTGTGAATGGACAGTGGCCTTTGGTTTTATTTTCTACTTCCTAACTTTCATCCAAGATTTCCAGAGTGTCACCCTAAGGATATCCACAGAAATCAATGGTGATATTTGA |
| ORF Protein Sequence | MLCFLRGMAFVPFLLVTWSSAAFIISYVVAVLSGHVNPFLPYISDTGTTPPESGIFGFMINFSAFLGAATMYTRYKIVQKQNQTCYFSTPVFNLVSLVLGLVGCFGMGIVANFQELAVPVVHDGGALLAFVCGVVYTLLQSIISYKSCPQWNSLSTCHIRMVISAVSCAAVIPMIVCASLISITKLEWNPREKDYVYHVVSAICEWTVAFGFIFYFLTFIQDFQSVTLRISTEINGDI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0728-Ab | Anti-DRAM1 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0728-Ag | DRAM1 protein |
| ORF Viral Vector | pGMLP004543 | Human DRAM1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-atg-023 | Human DRAM1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-atg-077 | Human DRAM1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP004543 | Human DRAM1 Lentivirus particle |
| ORF Viral Vector | vGMLP-atg-023 | Human DRAM1 Lentivirus particle |
| ORF Viral Vector | vGMAP-atg-077 | Human DRAM1 Adenovirus particle |
Target information
| Target ID | GM-IP0728 |
| Target Name | DRAM1 |
| Gene ID | 55332, 71712, 697427, 679937, 101081234, 612179, 533992, 100067057 |
| Gene Symbol and Synonyms | 1200002N14Rik,DRAM,DRAM1 |
| Uniprot Accession | Q8N682 |
| Uniprot Entry Name | DRAM1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000136048 |
| Target Classification | Not Available |
This gene is regulated as part of the p53 tumor suppressor pathway. The gene encodes a lysosomal membrane protein that is required for the induction of autophagy by the pathway. Decreased transcriptional expression of this gene is associated with various tumors. This gene has a pseudogene on chromosome 4. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


