Human ELANE/ELA2/ GE ORF/cDNA clone-Lentivirus plasmid (NM_001972)

Pre-made Human ELANE/ELA2/ GE Lentiviral expression plasmid for ELANE lentivirus packaging, ELANE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to NE/ELANE/ELA2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004544 Human ELANE Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004544
Gene Name ELANE
Accession Number NM_001972
Gene ID 1991
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 804 bp
Gene Alias ELA2, GE, HLE, HNE, NE, PMN-E, SCN1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCCTCGGCCGCCGACTCGCGTGTCTTTTCCTCGCCTGTGTCCTGCCGGCCTTGCTGCTGGGGGGCACCGCGCTGGCCTCGGAGATTGTGGGGGGCCGGCGAGCGCGGCCCCACGCGTGGCCCTTCATGGTGTCCCTGCAGCTGCGCGGAGGCCACTTCTGCGGCGCCACCCTGATTGCGCCCAACTTCGTCATGTCGGCCGCGCACTGCGTGGCGAATGTAAACGTCCGCGCGGTGCGGGTGGTCCTGGGAGCCCATAACCTCTCGCGGCGGGAGCCCACCCGGCAGGTGTTCGCCGTGCAGCGCATCTTCGAAAACGGCTACGACCCCGTAAACTTGCTCAACGACATCGTGATTCTCCAGCTCAACGGGTCGGCCACCATCAACGCCAACGTGCAGGTGGCCCAGCTGCCGGCTCAGGGACGCCGCCTGGGCAACGGGGTGCAGTGCCTGGCCATGGGCTGGGGCCTTCTGGGCAGGAACCGTGGGATCGCCAGCGTCCTGCAGGAGCTCAACGTGACGGTGGTGACGTCCCTCTGCCGTCGCAGCAACGTCTGCACTCTCGTGAGGGGCCGGCAGGCCGGCGTCTGTTTCGGGGACTCCGGCAGCCCCTTGGTCTGCAACGGGCTAATCCACGGAATTGCCTCCTTCGTCCGGGGAGGCTGCGCCTCAGGGCTCTACCCCGATGCCTTTGCCCCGGTGGCACAGTTTGTAAACTGGATCGACTCTATCATCCAACGCTCCGAGGACAACCCCTGTCCCCACCCCCGGGACCCGGACCCGGCCAGCAGGACCCACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T40332-Ab Anti-ELNE/ NE/ ELANE functional antibody
    Target Antigen GM-Tg-g-T40332-Ag NE/ELANE protein
    ORF Viral Vector pGMLP004544 Human ELANE Lentivirus plasmid
    ORF Viral Vector vGMLP004544 Human ELANE Lentivirus particle


    Target information

    Target ID GM-T40332
    Target Name NE
    Gene ID 1991, 50701, 106992354, 299606, 100301482, 442980, 100126050, 111774155
    Gene Symbol and Synonyms ELA2,ELANE,F430011M15Rik,GE,HLE,HNE,NE,PMN-E,SCN1
    Uniprot Accession P08246
    Uniprot Entry Name ELNE_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Interstitial cystitis (chronic)
    Gene Ensembl ENSG00000197561
    Target Classification Not Available

    Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode structurally similar proteins. The encoded preproprotein is proteolytically processed to generate the active protease. Following activation, this protease hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix. The enzyme may play a role in degenerative and inflammatory diseases through proteolysis of collagen-IV and elastin. This protein also degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Mutations in this gene are associated with cyclic neutropenia and severe congenital neutropenia (SCN). This gene is present in a gene cluster on chromosome 19. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.