Human IFNA16/IFN-alpha-16/ IFN-alphaO ORF/cDNA clone-Lentivirus plasmid (NM_002173)

Pre-made Human IFNA16/IFN-alpha-16/ IFN-alphaO Lentiviral expression plasmid for IFNA16 lentivirus packaging, IFNA16 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IFNA16/IFN-alpha-16 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004551 Human IFNA16 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004551
Gene Name IFNA16
Accession Number NM_002173
Gene ID 3449
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 570 bp
Gene Alias IFN-alpha-16, IFN-alphaO
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGCTGTGATCTGCCTCAGACTCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGCACAAATGGGAAGAATCTCTCATTTCTCCTGCCTGAAGGACAGATATGATTTCGGATTCCCCCAGGAGGTGTTTGATGGCAACCAGTTCCAGAAGGCTCAAGCCATCTCTGCCTTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAAAGGATTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACATTGAACTTTTCCAGCAACTGAATGACCTAGAAGCCTGTGTGACACAGGAGGTTGGGGTGGAAGAGATTGCCCTGATGAATGAGGACTCCATCCTGGCTGTGAGGAAATACTTTCAAAGAATCACTCTTTATCTGATGGGGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTTTTCAACAAACTTGCAAAAAGGATTAAGAAGGAAGGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0979-Ab Anti-IFN16/ IFNA16/ IFN-alpha-16 functional antibody
    Target Antigen GM-Tg-g-SE0979-Ag IFNA16 protein
    Cytokine cks-Tg-g-GM-SE0979 interferon, alpha 16 (IFNA16) protein & antibody
    ORF Viral Vector pGMLP004551 Human IFNA16 Lentivirus plasmid
    ORF Viral Vector vGMLP004551 Human IFNA16 Lentivirus particle


    Target information

    Target ID GM-SE0979
    Target Name IFNA16
    Gene ID 3449
    Gene Symbol and Synonyms IFN-alpha-16,IFN-alphaO,IFNA16
    Uniprot Accession P05015
    Uniprot Entry Name IFN16_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000147885
    Target Classification Not Available

    Predicted to enable cytokine activity and type I interferon receptor binding activity. Predicted to be involved in several processes, including B cell activation; lymphocyte activation involved in immune response; and positive regulation of peptidyl-serine phosphorylation of STAT protein. Predicted to be located in extracellular region. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.