Human TMEM52B/C12orf59 ORF/cDNA clone-Lentivirus plasmid (NM_153022)

Pre-made Human TMEM52B/C12orf59 Lentiviral expression plasmid for TMEM52B lentivirus packaging, TMEM52B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TMEM52B/C12orf59 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004561 Human TMEM52B Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004561
Gene Name TMEM52B
Accession Number NM_153022
Gene ID 120939
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 492 bp
Gene Alias C12orf59
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCGTGGCGGCCTCAGCCCTGCTGTATTTCATCCTGTTGCCTGACCACAGACTGGGTACATCTCTGGTATATATGGTTGCTAGTGGTAATTGGCGCGCTGCTTCTCCTGTGTGGCCTGACGTCCCTGTGCTTCCGCTGCTGCTGTCTGAGCCGCCAGCAAAATGGGGAAGATGGGGGCCCACCACCCTGTGAAGTGACCGTCATTGCTTTCGATCACGACAGCACTCTCCAGAGCACTATCACATCTCTGCAGTCGGTGTTTGGCCCTGCAGCTCGGAGGATCCTGGCTGTGGCTCACTCCCACAGCTCCCTGGGCCAGCTGCCCTCCTCTTTGGACACCCTCCCAGGGTATGAAGAAGCTCTTCACATGAGTCGCTTCACAGTAGCCATGTGCGGGCAGAAAGCACCTGATCTACCCCCAGTACCTGAAGAAAAGCAGCTGCCTCCAACAGAGAAGGAGTCGACTCGAATAGTTGACTCTTGGAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2109-Ab Anti-TMEM52B monoclonal antibody
    Target Antigen GM-Tg-g-IP2109-Ag TMEM52B protein
    ORF Viral Vector pGMLP004561 Human TMEM52B Lentivirus plasmid
    ORF Viral Vector pGMAP000478 Human TMEM52B Adenovirus plasmid
    ORF Viral Vector vGMLP004561 Human TMEM52B Lentivirus particle
    ORF Viral Vector vGMAP000478 Human TMEM52B Adenovirus particle


    Target information

    Target ID GM-IP2109
    Target Name TMEM52B
    Gene ID 120939, 330428, 722332, 689963, 101086487, 611378, 618567, 100062403
    Gene Symbol and Synonyms C12orf59,C5H12orf59,D630042F21Rik,TMEM52B
    Uniprot Accession Q4KMG9
    Uniprot Entry Name TM52B_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000165685
    Target Classification Not Available

    Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.