Human C12orf59 ORF/cDNA clone-Adenovirus particle (BC131523)

Cat. No.: vGMAP000478

Pre-made Human C12orf59/ Adenovirus for C12orf59 overexpression in-vitro and in-vivo. The C12orf59 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified C12orf59-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to TMEM52B/C12orf59/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000478 Human C12orf59 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000478
Gene Name C12orf59
Accession Number BC131523
Gene ID 120939
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 552 bp
Gene Alias
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGGAGTCCGAGTTCATGTCGTGGCGGCCTCAGCCCTGCTGTATTTCATCCTGCTTTCTGGGACGAGATGTGAGGAAAACTGTGGTAATCCTGAACATTGCCTGACCACAGACTGGGTACATCTCTGGTATATATGGTTGCTAGTGGTAATTGGCGCGCTGCTTCTCCTGTGTGGCCTGACGTCCCTGTGCTTCCGCTGCTGCTGTCTGAGCCGCCAGCAAAATGGGGAAGATGGGGGCCCACCACCCTGTGAAGTGACCGTCATTGCTTTCGATCACGACAGCACTCTCCAGAGCACTATCACATCTCTGCAGTCGGTGTTTGGCCCTGCAGCTCGGAGGATCCTGGCTGTGGCTCACTCCCACAGCTCCCTGGGCCAGCTGCCCTCCTCTTTGGACACCCTCCCAGGGTATGAAGAAGCTCTTCACATGAGTCGCTTCACAGTAGCCATGTGCGGGCAGAAAGCACCTGATCTACCCCCAGTACCTGAAGAAAAGCAGCTGCCTCCAACAGAGAAGGAGTCGACTCGAATAGTTGACTCTTGGAACTGA
ORF Protein Sequence MGVRVHVVAASALLYFILLSGTRCEENCGNPEHCLTTDWVHLWYIWLLVVIGALLLLCGLTSLCFRCCCLSRQQNGEDGGPPPCEVTVIAFDHDSTLQSTITSLQSVFGPAARRILAVAHSHSSLGQLPSSLDTLPGYEEALHMSRFTVAMCGQKAPDLPPVPEEKQLPPTEKESTRIVDSWN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2109-Ab Anti-TMEM52B monoclonal antibody
    Target Antigen GM-Tg-g-IP2109-Ag TMEM52B protein
    ORF Viral Vector pGMLP004561 Human TMEM52B Lentivirus plasmid
    ORF Viral Vector pGMAP000478 Human C12orf59 Adenovirus plasmid
    ORF Viral Vector vGMLP004561 Human TMEM52B Lentivirus particle
    ORF Viral Vector vGMAP000478 Human C12orf59 Adenovirus particle


    Target information

    Target ID GM-IP2109
    Target Name TMEM52B
    Gene ID 120939, 330428, 722332, 689963, 101086487, 611378, 618567, 100062403
    Gene Symbol and Synonyms C12orf59,C5H12orf59,D630042F21Rik,TMEM52B
    Uniprot Accession Q4KMG9
    Uniprot Entry Name TM52B_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000165685
    Target Classification Not Available

    Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.