Human SRD5A2 ORF/cDNA clone-Lentivirus plasmid (NM_000348)
Pre-made Human SRD5A2/ Lentiviral expression plasmid for SRD5A2 lentivirus packaging, SRD5A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SRD5A2/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004602 | Human SRD5A2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004602 |
Gene Name | SRD5A2 |
Accession Number | NM_000348 |
Gene ID | 6716 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 765 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGGTTCAGTGCCAGCAGAGCCCAGTGCTGGCAGGCAGCGCCACTTTGGTCGCCCTTGGGGCACTGGCCTTGTACGTCGCGAAGCCCTCCGGCTACGGGAAGCACACGGAGAGCCTGAAGCCGGCGGCTACCCGCCTGCCAGCCCGCGCCGCCTGGTTCCTGCAGGAGCTGCCTTCCTTCGCGGTGCCCGCGGGGATCCTCGCCCGGCAGCCCCTCTCCCTCTTCGGGCCACCTGGGACGGTACTTCTGGGCCTCTTCTGCCTACATTACTTCCACAGGACATTTGTGTACTCACTGCTCAATCGAGGGAGGCCTTATCCAGCTATACTCATTCTCAGAGGCACTGCCTTCTGCACTGGAAATGGAGTCCTTCAAGGCTACTATCTGATTTACTGTGCTGAATACCCTGATGGGTGGTACACAGACATACGGTTTAGCTTGGGTGTCTTCTTATTTATTTTGGGAATGGGAATAAACATTCATAGTGACTATATATTGCGCCAGCTCAGGAAGCCTGGAGAAATCAGCTACAGGATTCCACAAGGTGGCTTGTTTACGTATGTTTCTGGAGCCAATTTCCTCGGTGAGATCATTGAATGGATCGGCTATGCCCTGGCCACTTGGTCCCTCCCAGCACTTGCATTTGCATTTTTCTCACTTTGTTTCCTTGGGCTGCGAGCTTTTCACCACCATAGGTTCTACCTCAAGATGTTTGAGGACTACCCCAAATCTCGGAAAGCCCTTATTCCATTCATCTTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0020-Ab | Anti-SRD5A2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0020-Ag | SRD5A2 protein |
ORF Viral Vector | pGMLP004602 | Human SRD5A2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004602 | Human SRD5A2 Lentivirus particle |
Target information
Target ID | GM-IP0020 |
Target Name | SRD5A2 |
Gene ID | 6716, 94224, 705676, 64677, 101086898, 403715, 527024, 100070655 |
Gene Symbol and Synonyms | 5ART2,S5AR 2,SRD5A2 |
Uniprot Accession | P31213 |
Uniprot Entry Name | S5A2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate disease |
Gene Ensembl | ENSG00000277893 |
Target Classification | Not Available |
This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.