Human SRD5A2 ORF/cDNA clone-Lentivirus plasmid (NM_000348)

Pre-made Human SRD5A2/ Lentiviral expression plasmid for SRD5A2 lentivirus packaging, SRD5A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SRD5A2/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004602 Human SRD5A2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004602
Gene Name SRD5A2
Accession Number NM_000348
Gene ID 6716
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 765 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGTTCAGTGCCAGCAGAGCCCAGTGCTGGCAGGCAGCGCCACTTTGGTCGCCCTTGGGGCACTGGCCTTGTACGTCGCGAAGCCCTCCGGCTACGGGAAGCACACGGAGAGCCTGAAGCCGGCGGCTACCCGCCTGCCAGCCCGCGCCGCCTGGTTCCTGCAGGAGCTGCCTTCCTTCGCGGTGCCCGCGGGGATCCTCGCCCGGCAGCCCCTCTCCCTCTTCGGGCCACCTGGGACGGTACTTCTGGGCCTCTTCTGCCTACATTACTTCCACAGGACATTTGTGTACTCACTGCTCAATCGAGGGAGGCCTTATCCAGCTATACTCATTCTCAGAGGCACTGCCTTCTGCACTGGAAATGGAGTCCTTCAAGGCTACTATCTGATTTACTGTGCTGAATACCCTGATGGGTGGTACACAGACATACGGTTTAGCTTGGGTGTCTTCTTATTTATTTTGGGAATGGGAATAAACATTCATAGTGACTATATATTGCGCCAGCTCAGGAAGCCTGGAGAAATCAGCTACAGGATTCCACAAGGTGGCTTGTTTACGTATGTTTCTGGAGCCAATTTCCTCGGTGAGATCATTGAATGGATCGGCTATGCCCTGGCCACTTGGTCCCTCCCAGCACTTGCATTTGCATTTTTCTCACTTTGTTTCCTTGGGCTGCGAGCTTTTCACCACCATAGGTTCTACCTCAAGATGTTTGAGGACTACCCCAAATCTCGGAAAGCCCTTATTCCATTCATCTTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0020-Ab Anti-SRD5A2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0020-Ag SRD5A2 protein
    ORF Viral Vector pGMLP004602 Human SRD5A2 Lentivirus plasmid
    ORF Viral Vector vGMLP004602 Human SRD5A2 Lentivirus particle


    Target information

    Target ID GM-IP0020
    Target Name SRD5A2
    Gene ID 6716, 94224, 705676, 64677, 101086898, 403715, 527024, 100070655
    Gene Symbol and Synonyms 5ART2,S5AR 2,SRD5A2
    Uniprot Accession P31213
    Uniprot Entry Name S5A2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate disease
    Gene Ensembl ENSG00000277893
    Target Classification Not Available

    This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.