Human GPCR/GPCR/MGRG2 ORF/cDNA clone-Lentivirus plasmid (NM_147199)

Cat. No.: pGMLP004679
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPCR/GPCR/MGRG2 Lentiviral expression plasmid for GPCR lentivirus packaging, GPCR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MRGX1/GPCR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $542.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004679
Gene Name GPCR
Accession Number NM_147199
Gene ID 259249
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 969 bp
Gene Alias GPCR,MGRG2,MRGX1,SNSR4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCCAACCATCTCAACCTTGGACACAGAACTGACACCAATCAACGGAACTGAGGAGACTCTTTGCTACAAGCAGACCTTGAGCCTCACGGTGCTGACGTGCATCGTTTCCCTTGTCGGGCTGACAGGAAACGCAGTTGTGCTCTGGCTCCTGGGCTGCCGCATGCGCAGGAACGCCTTCTCCATCTACATCCTCAACTTGGCCGCAGCAGACTTCCTCTTCCTCAGCGGCCGCCTTATATATTCCCTGTTAAGCTTCATCAGTATCCCCCATACCATCTCTAAAATCCTCTATCCTGTGATGATGTTTTCCTACTTTGCAGGCCTGAGCTTTCTGAGTGCCGTGAGCACCGAGCGCTGCCTGTCCGTCCTGTGGCCCATCTGGTACCGCTGCCACCGCCCCACACACCTGTCAGCGGTGGTGTGTGTCCTGCTCTGGGCCCTGTCCCTGCTGCGGAGCATCCTGGAGTGGATGTTATGTGGCTTCCTGTTCAGTGGTGCTGATTCTGCTTGGTGTCAAACATCAGATTTCATCACAGTCGCGTGGCTGATTTTTTTATGTGTGGTTCTCTGTGGGTCCAGCCTGGTCCTGCTGATCAGGATTCTCTGTGGATCCCGGAAGATACCGCTGACCAGGCTGTACGTGACCATCCTGCTCACAGTACTGGTCTTCCTCCTCTGTGGCCTGCCCTTTGGCATTCAGTTTTTCCTATTTTTATGGATCCACGTGGACAGGGAAGTCTTATTTTGTCATGTTCATCTAGTTTCTATTTTCCTGTCCGCTCTTAACAGCAGTGCCAACCCCATCATTTACTTCTTCGTGGGCTCCTTTAGGCAGCGTCAAAATAGGCAGAACCTGAAGCTGGTTCTCCAGAGGGCTCTGCAGGACGCGTCTGAGGTGGATGAAGGTGGAGGGCAGCTTCCTGAGGAAATCCTGGAGCTGTCGGGAAGCAGATTGGAGCAGTGA
ORF Protein Sequence MDPTISTLDTELTPINGTEETLCYKQTLSLTVLTCIVSLVGLTGNAVVLWLLGCRMRRNAFSIYILNLAAADFLFLSGRLIYSLLSFISIPHTISKILYPVMMFSYFAGLSFLSAVSTERCLSVLWPIWYRCHRPTHLSAVVCVLLWALSLLRSILEWMLCGFLFSGADSAWCQTSDFITVAWLIFLCVVLCGSSLVLLIRILCGSRKIPLTRLYVTILLTVLVFLLCGLPFGIQFFLFLWIHVDREVLFCHVHLVSIFLSALNSSANPIIYFFVGSFRQRQNRQNLKLVLQRALQDASEVDEGGGQLPEEILELSGSRLEQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57253-Ab Anti-MRGX1/ MRGPRX1/ GPCR monoclonal antibody
    Target Antigen GM-Tg-g-T57253-Ag MRGX1/MRGPRX1 VLP (virus-like particle)
    ORF Viral Vector pGMLP004679 Human GPCR Lentivirus plasmid
    ORF Viral Vector vGMLP004679 Human GPCR Lentivirus particle


    Target information

    Target ID GM-T57253
    Target Name MRGX1
    Gene ID 259249
    Gene Symbol and Synonyms GPCR,MGRG2,MRGPRX1,MRGX1,SNSR4
    Uniprot Accession Q96LB2
    Uniprot Entry Name MRGX1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170255
    Target Classification GPCR

    Enables transmembrane signaling receptor activity. Involved in cell surface receptor signaling pathway and response to chloroquine. Predicted to be located in cell surface. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.