Human SFTA3/NANCI/ SFTPH ORF/cDNA clone-Lentivirus plasmid (NM_001101341)

Pre-made Human SFTA3/NANCI/ SFTPH Lentiviral expression plasmid for SFTA3 lentivirus packaging, SFTA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SFTA3/NANCI products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004682 Human SFTA3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004682
Gene Name SFTA3
Accession Number NM_001101341
Gene ID 253970
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 285 bp
Gene Alias NANCI, SFTPH, SP-H, SPH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGAGCCGGGTTTTCTGACTTCCAACTCATTAGGGACCAGGTTCTTTTTCTTCAGGATCAGGCACAGAGACTGACTGAATGGCTCCAATTATCAGGATTTGAAAACCCAGTATCAGAATCTACCACTTTGTGCCTGAGGGAGAGGGAAAAGCGGATACCCACCTGTGTCGCTGTTTGCGTGCCAAGTCCAGGAACAGTCCATACAGCCCTGCTGCATCCCACGACGCTGTCACAAAGCAGGAGTTCATCCGAGGCCAAGATGTTAATTATTCATACTGCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1660-Ab Anti-SFTA3/ NANCI/ SFTPH functional antibody
    Target Antigen GM-Tg-g-SE1660-Ag SFTA3 protein
    ORF Viral Vector pGMLP004682 Human SFTA3 Lentivirus plasmid
    ORF Viral Vector vGMLP004682 Human SFTA3 Lentivirus particle


    Target information

    Target ID GM-SE1660
    Target Name SFTA3
    Gene ID 253970, 106999400
    Gene Symbol and Synonyms NANCI,PAHRF,SFTA3,SFTPH,SP-H,SPH
    Uniprot Accession P0C7M3
    Uniprot Entry Name SFTA3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000229415
    Target Classification Not Available

    Involved in wound healing. Located in cytoplasm and extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.