Human NANCI/NANCI/SFTPH ORF/cDNA clone-Lentivirus particle (NM_001101341)

Cat. No.: vGMLP004682

Pre-made Human NANCI/NANCI/SFTPH Lentiviral expression plasmid for NANCI lentivirus packaging, NANCI lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SFTA3/NANCI products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004682 Human NANCI Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004682
Gene Name NANCI
Accession Number NM_001101341
Gene ID 253970
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 285 bp
Gene Alias NANCI,SFTPH,SP-H,SPH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGAGCCGGGTTTTCTGACTTCCAACTCATTAGGGACCAGGTTCTTTTTCTTCAGGATCAGGCACAGAGACTGACTGAATGGCTCCAATTATCAGGATTTGAAAACCCAGTATCAGAATCTACCACTTTGTGCCTGAGGGAGAGGGAAAAGCGGATACCCACCTGTGTCGCTGTTTGCGTGCCAAGTCCAGGAACAGTCCATACAGCCCTGCTGCATCCCACGACGCTGTCACAAAGCAGGAGTTCATCCGAGGCCAAGATGTTAATTATTCATACTGCATGA
ORF Protein Sequence MRAGFSDFQLIRDQVLFLQDQAQRLTEWLQLSGFENPVSESTTLCLREREKRIPTCVAVCVPSPGTVHTALLHPTTLSQSRSSSEAKMLIIHTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1660-Ab Anti-SFTA3/ NANCI/ SFTPH functional antibody
    Target Antigen GM-Tg-g-SE1660-Ag SFTA3 protein
    ORF Viral Vector pGMLP004682 Human NANCI Lentivirus plasmid
    ORF Viral Vector vGMLP004682 Human NANCI Lentivirus particle


    Target information

    Target ID GM-SE1660
    Target Name SFTA3
    Gene ID 253970, 106999400
    Gene Symbol and Synonyms NANCI,PAHRF,SFTA3,SFTPH,SP-H,SPH
    Uniprot Accession P0C7M3
    Uniprot Entry Name SFTA3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000229415
    Target Classification Not Available

    Involved in wound healing. Located in cytoplasm and extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.