Human Cox7a2/COX7AL/COX7AL1 ORF/cDNA clone-Lentivirus plasmid (NM_001865)

Cat. No.: pGMLP004685
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human Cox7a2/COX7AL/COX7AL1 Lentiviral expression plasmid for Cox7a2 lentivirus packaging, Cox7a2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to COX7A2/Cox7a2/COX7AL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004685
Gene Name Cox7a2
Accession Number NM_001865
Gene ID 1347
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 348 bp
Gene Alias COX7AL,COX7AL1,COXVIIa-L,COXVIIAL,VIIAL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGA
ORF Protein Sequence MLRNLLALRQIGQRTISTASRRHFKNKVPEKQKLFQEDDEIPLYLKGGVADALLYRATMILTVGGTAYAIYELAVASFPKKQE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0604-Ab Anti-COX7A2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0604-Ag COX7A2 protein
    ORF Viral Vector pGMLP004685 Human Cox7a2 Lentivirus plasmid
    ORF Viral Vector vGMLP004685 Human Cox7a2 Lentivirus particle


    Target information

    Target ID GM-IP0604
    Target Name COX7A2
    Gene ID 1347, 12866, 717879, 29507, 101093608, 119863903, 327688, 100630209
    Gene Symbol and Synonyms COX7A2,Cox7a3,COX7AL,COX7AL1,COXVIIa-L,COXVIIAL,LOC119863903,LOC717879,VIIAL
    Uniprot Accession P14406
    Uniprot Entry Name CX7A2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000112695
    Target Classification Not Available

    Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.