Human IL19/IL-10C/ MDA1 ORF/cDNA clone-Lentivirus plasmid (NM_153758)
Pre-made Human IL19/IL-10C/ MDA1 Lentiviral expression plasmid for IL19 lentivirus packaging, IL19 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL19/IL-10C products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004788 | Human IL19 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004788 |
Gene Name | IL19 |
Accession Number | NM_153758 |
Gene ID | 29949 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 648 bp |
Gene Alias | IL-10C, MDA1, NG.1, ZMDA1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGCACTGAGGGAGCGTTTCCGCACAGATCTGCGTGTTCCTTACCACTCACACATGTGCACACACATATCCATGTGTGTGTGCCAGTGCTTTGGGGCTCTGTTCCACGGGGCATGAAGTTACAGTGTGTTTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAACCACGGTCTCAGGAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAAGAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACATTGGAGACTCTGCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTGGCGTTCTACGTGGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGAAAAATCAGCAGCATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAGGAACAGAGGCAGTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGACAACTATGATCAGCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTCTTTCTAGCCTGGATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T44584-Ab | Anti-IL19/ IL-10C/ MDA1 functional antibody |
Target Antigen | GM-Tg-g-T44584-Ag | IL19 protein |
Cytokine | cks-Tg-g-GM-T44584 | IL19 (IL19) protein & antibody |
ORF Viral Vector | pGMLP004788 | Human IL19 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-026 | Human IL19 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-109 | Human IL19 Adenovirus plasmid |
ORF Viral Vector | vGMLP004788 | Human IL19 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-026 | Human IL19 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-109 | Human IL19 Adenovirus particle |
Target information
Target ID | GM-T44584 |
Target Name | IL19 |
Gene ID | 29949, 329244, 694806, 681145, 101090582, 490265, 527634, 100055588 |
Gene Symbol and Synonyms | IL-10C,IL19,MDA1,NG.1,ZMDA1 |
Uniprot Accession | Q9UHD0 |
Uniprot Entry Name | IL19_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000142224 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.