Human IL19/IL-10C/ MDA1 ORF/cDNA clone-Lentivirus particle (NM_153758)

Pre-made Human IL19/IL-10C/ MDA1 Lentiviral expression plasmid for IL19 lentivirus packaging, IL19 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL19/IL-10C products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004788 Human IL19 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004788
Gene Name IL19
Accession Number NM_153758
Gene ID 29949
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 648 bp
Gene Alias IL-10C, MDA1, NG.1, ZMDA1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCACTGAGGGAGCGTTTCCGCACAGATCTGCGTGTTCCTTACCACTCACACATGTGCACACACATATCCATGTGTGTGTGCCAGTGCTTTGGGGCTCTGTTCCACGGGGCATGAAGTTACAGTGTGTTTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAACCACGGTCTCAGGAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAAGAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACATTGGAGACTCTGCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTGGCGTTCTACGTGGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGAAAAATCAGCAGCATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAGGAACAGAGGCAGTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGACAACTATGATCAGCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTCTTTCTAGCCTGGATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44584-Ab Anti-IL19/ IL-10C/ MDA1 functional antibody
    Target Antigen GM-Tg-g-T44584-Ag IL19 protein
    Cytokine cks-Tg-g-GM-T44584 IL19 (IL19) protein & antibody
    ORF Viral Vector pGMLP004788 Human IL19 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-026 Human IL19 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-109 Human IL19 Adenovirus plasmid
    ORF Viral Vector vGMLP004788 Human IL19 Lentivirus particle
    ORF Viral Vector vGMLP-IL-026 Human IL19 Lentivirus particle
    ORF Viral Vector vGMAP-IL-109 Human IL19 Adenovirus particle


    Target information

    Target ID GM-T44584
    Target Name IL19
    Gene ID 29949, 329244, 694806, 681145, 101090582, 490265, 527634, 100055588
    Gene Symbol and Synonyms IL-10C,IL19,MDA1,NG.1,ZMDA1
    Uniprot Accession Q9UHD0
    Uniprot Entry Name IL19_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000142224
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.