Human LTB/p33/ TNFC ORF/cDNA clone-Lentivirus plasmid (NM_002341)
Pre-made Human LTB/p33/ TNFC Lentiviral expression plasmid for LTB lentivirus packaging, LTB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to LTB/p33 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004791 | Human LTB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004791 |
Gene Name | LTB |
Accession Number | NM_002341 |
Gene ID | 4050 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 735 bp |
Gene Alias | p33, TNFC, TNFSF3, TNLG1C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGGCACTGGGGCTGGAGGGCAGGGGTGGGAGGCTCCAGGGGAGGGGTTCCCTCCTGCTAGCTGTGGCAGGAGCCACTTCTCTGGTGACCTTGTTGCTGGCGGTGCCTATCACTGTCCTGGCTGTGCTGGCCTTAGTGCCCCAGGATCAGGGAGGACTGGTAACGGAGACGGCCGACCCCGGGGCACAGGCCCAGCAAGGACTGGGGTTTCAGAAGCTGCCAGAGGAGGAGCCAGAAACAGATCTCAGCCCCGGGCTCCCAGCTGCCCACCTCATAGGCGCTCCGCTGAAGGGGCAGGGGCTAGGCTGGGAGACGACGAAGGAACAGGCGTTTCTGACGAGCGGGACGCAGTTCTCGGACGCCGAGGGGCTGGCGCTCCCGCAGGACGGCCTCTATTACCTCTACTGTCTCGTCGGCTACCGGGGCCGGGCGCCCCCTGGCGGCGGGGACCCCCAGGGCCGCTCGGTCACGCTGCGCAGCTCTCTGTACCGGGCGGGGGGCGCCTACGGGCCGGGCACTCCCGAGCTGCTGCTCGAGGGCGCCGAGACGGTGACTCCAGTGCTGGACCCGGCCAGGAGACAAGGGTACGGGCCTCTCTGGTACACGAGCGTGGGGTTCGGCGGCCTGGTGCAGCTCCGGAGGGGCGAGAGGGTGTACGTCAACATCAGTCACCCCGATATGGTGGACTTCGCGAGAGGGAAGACCTTCTTTGGGGCCGTGATGGTGGGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T20221-Ab | Anti-TNFC/ LTB/ TNFSF3 monoclonal antibody |
Target Antigen | GM-Tg-g-T20221-Ag | LTB VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T20221 | lymphotoxin beta (TNF superfamily, member 3) (LTB) protein & antibody |
ORF Viral Vector | pGMLP004791 | Human LTB Lentivirus plasmid |
ORF Viral Vector | vGMLP004791 | Human LTB Lentivirus particle |
Target information
Target ID | GM-T20221 |
Target Name | LTB |
Gene ID | 4050, 16994, 715518, 361795, 101085208, 481712, 529757, 100058364 |
Gene Symbol and Synonyms | LTB,LTbeta,p33,TNFC,TNFSF3,TNLG1C |
Uniprot Accession | Q06643 |
Uniprot Entry Name | TNFC_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000227507 |
Target Classification | Tumor-associated antigen (TAA) |
Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.