Human LTB/p33/ TNFC ORF/cDNA clone-Lentivirus plasmid (NM_002341)

Pre-made Human LTB/p33/ TNFC Lentiviral expression plasmid for LTB lentivirus packaging, LTB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to LTB/p33 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004791 Human LTB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004791
Gene Name LTB
Accession Number NM_002341
Gene ID 4050
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 735 bp
Gene Alias p33, TNFC, TNFSF3, TNLG1C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGGCACTGGGGCTGGAGGGCAGGGGTGGGAGGCTCCAGGGGAGGGGTTCCCTCCTGCTAGCTGTGGCAGGAGCCACTTCTCTGGTGACCTTGTTGCTGGCGGTGCCTATCACTGTCCTGGCTGTGCTGGCCTTAGTGCCCCAGGATCAGGGAGGACTGGTAACGGAGACGGCCGACCCCGGGGCACAGGCCCAGCAAGGACTGGGGTTTCAGAAGCTGCCAGAGGAGGAGCCAGAAACAGATCTCAGCCCCGGGCTCCCAGCTGCCCACCTCATAGGCGCTCCGCTGAAGGGGCAGGGGCTAGGCTGGGAGACGACGAAGGAACAGGCGTTTCTGACGAGCGGGACGCAGTTCTCGGACGCCGAGGGGCTGGCGCTCCCGCAGGACGGCCTCTATTACCTCTACTGTCTCGTCGGCTACCGGGGCCGGGCGCCCCCTGGCGGCGGGGACCCCCAGGGCCGCTCGGTCACGCTGCGCAGCTCTCTGTACCGGGCGGGGGGCGCCTACGGGCCGGGCACTCCCGAGCTGCTGCTCGAGGGCGCCGAGACGGTGACTCCAGTGCTGGACCCGGCCAGGAGACAAGGGTACGGGCCTCTCTGGTACACGAGCGTGGGGTTCGGCGGCCTGGTGCAGCTCCGGAGGGGCGAGAGGGTGTACGTCAACATCAGTCACCCCGATATGGTGGACTTCGCGAGAGGGAAGACCTTCTTTGGGGCCGTGATGGTGGGGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20221-Ab Anti-TNFC/ LTB/ TNFSF3 monoclonal antibody
    Target Antigen GM-Tg-g-T20221-Ag LTB VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T20221 lymphotoxin beta (TNF superfamily, member 3) (LTB) protein & antibody
    ORF Viral Vector pGMLP004791 Human LTB Lentivirus plasmid
    ORF Viral Vector vGMLP004791 Human LTB Lentivirus particle


    Target information

    Target ID GM-T20221
    Target Name LTB
    Gene ID 4050, 16994, 715518, 361795, 101085208, 481712, 529757, 100058364
    Gene Symbol and Synonyms LTB,LTbeta,p33,TNFC,TNFSF3,TNLG1C
    Uniprot Accession Q06643
    Uniprot Entry Name TNFC_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000227507
    Target Classification Tumor-associated antigen (TAA)

    Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.