Human PEMT/PEAMT/ PEMPT ORF/cDNA clone-Lentivirus plasmid (NM_001267551)

Pre-made Human PEMT/PEAMT/ PEMPT Lentiviral expression plasmid for PEMT lentivirus packaging, PEMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PEMT/PEAMT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004853 Human PEMT Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004853
Gene Name PEMT
Accession Number NM_001267551
Gene ID 10400
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 645 bp
Gene Alias PEAMT, PEMPT, PEMT2, PLMT, PNMT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGAGATCTGGGAACCCGGGAGCCGAGGCAGACTTCTGCGTTATGACCCGGCTGCTGGGCTACGTGGACCCCCTGGATCCCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATCCGCTCTACTGGAATGTGGTTGCACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCTTCGGATCCCCCTACCTGGCCTGCTACTCTCTAAGCGTCACCATCCTGCTCCTGAACTTCCTGCGCTCGCACTGCTTCACGCAGGCCATGCTGAGCCAGCCCAGGATGGAGAGCCTGGACACCCCCGCGGCCTACAGCCTGGGCCTCGCGCTCCTGGGACTGGGCGTCGTGCTCGTGCTCTCCAGCTTCTTTGCACTGGGGTTCGCTGGAACTTTCCTAGGTGATTACTTCGGGATCCTCAAGGAGGCGAGAGTGACCGTGTTCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAAGCACAGCCAACTACCTGGGCTGGGCCATCATGCACGCCAGCCCCACGGGCCTGCTCCTGACGGTGCTGGTGGCCCTCACCTACATAGTGGCTCTCCTATACGAAGAGCCCTTCACCGCTGAGATCTACCGGCAGAAAGCCTCCGGGTCCCACAAGAGGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0167-Ab Anti-PEMT monoclonal antibody
    Target Antigen GM-Tg-g-IP0167-Ag PEMT protein
    ORF Viral Vector pGMAD000254 Rat Pemt Adenovirus plasmid
    ORF Viral Vector pGMLP004853 Human PEMT Lentivirus plasmid
    ORF Viral Vector vGMAD000254 Rat Pemt Adenovirus particle
    ORF Viral Vector vGMLP004853 Human PEMT Lentivirus particle


    Target information

    Target ID GM-IP0167
    Target Name PEMT
    Gene ID 10400, 18618, 699083, 25511, 101088035, 479526, 360197, 100050945
    Gene Symbol and Synonyms PEAMT,PEMPT,Pempt2,PEMT,PEMT2,PHOMETH,PLMT,PNMT
    Uniprot Accession Q9UBM1
    Uniprot Entry Name PEMT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000133027
    Target Classification Not Available

    Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.