Human PEMT/PEAMT/PEMPT ORF/cDNA clone-Lentivirus plasmid (NM_001267551)
Cat. No.: pGMLP004853
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PEMT/PEAMT/PEMPT Lentiviral expression plasmid for PEMT lentivirus packaging, PEMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PEMT/PEAMT products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004853 |
Gene Name | PEMT |
Accession Number | NM_001267551 |
Gene ID | 10400 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 645 bp |
Gene Alias | PEAMT,PEMPT,PEMT2,PLMT,PNMT |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGAGATCTGGGAACCCGGGAGCCGAGGCAGACTTCTGCGTTATGACCCGGCTGCTGGGCTACGTGGACCCCCTGGATCCCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATCCGCTCTACTGGAATGTGGTTGCACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCTTCGGATCCCCCTACCTGGCCTGCTACTCTCTAAGCGTCACCATCCTGCTCCTGAACTTCCTGCGCTCGCACTGCTTCACGCAGGCCATGCTGAGCCAGCCCAGGATGGAGAGCCTGGACACCCCCGCGGCCTACAGCCTGGGCCTCGCGCTCCTGGGACTGGGCGTCGTGCTCGTGCTCTCCAGCTTCTTTGCACTGGGGTTCGCTGGAACTTTCCTAGGTGATTACTTCGGGATCCTCAAGGAGGCGAGAGTGACCGTGTTCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAAGCACAGCCAACTACCTGGGCTGGGCCATCATGCACGCCAGCCCCACGGGCCTGCTCCTGACGGTGCTGGTGGCCCTCACCTACATAGTGGCTCTCCTATACGAAGAGCCCTTCACCGCTGAGATCTACCGGCAGAAAGCCTCCGGGTCCCACAAGAGGAGCTGA |
ORF Protein Sequence | MKRSGNPGAEADFCVMTRLLGYVDPLDPSFVAAVITITFNPLYWNVVARWEHKTRKLSRAFGSPYLACYSLSVTILLLNFLRSHCFTQAMLSQPRMESLDTPAAYSLGLALLGLGVVLVLSSFFALGFAGTFLGDYFGILKEARVTVFPFNILDNPMYWGSTANYLGWAIMHASPTGLLLTVLVALTYIVALLYEEPFTAEIYRQKASGSHKRS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0167-Ab | Anti-PEMT monoclonal antibody |
Target Antigen | GM-Tg-g-IP0167-Ag | PEMT protein |
ORF Viral Vector | pGMLP004853 | Human PEMT Lentivirus plasmid |
ORF Viral Vector | vGMLP004853 | Human PEMT Lentivirus particle |
Target information
Target ID | GM-IP0167 |
Target Name | PEMT |
Gene ID | 10400, 18618, 699083, 25511, 101088035, 479526, 360197, 100050945 |
Gene Symbol and Synonyms | PEAMT,PEMPT,Pempt2,PEMT,PEMT2,PHOMETH,PLMT,PNMT |
Uniprot Accession | Q9UBM1 |
Uniprot Entry Name | PEMT_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000133027 |
Target Classification | Not Available |
Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.