Human CXCL11/b-R1/ H174 ORF/cDNA clone-Lentivirus plasmid (NM_001302123)
Pre-made Human CXCL11/b-R1/ H174 Lentiviral expression plasmid for CXCL11 lentivirus packaging, CXCL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CXCL11/b-R1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004889 | Human CXCL11 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004889 |
Gene Name | CXCL11 |
Accession Number | NM_001302123 |
Gene ID | 6373 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 321 bp |
Gene Alias | b-R1, H174, I-TAC, IP-9, IP9, SCYB11, SCYB9B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTGATATTGTGTGCTACAGTTGTTCAAGGCTTCCCCATGTTCAAAAGAGGACGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAGAAAGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATAGAAGTGATTATTACCCTGAAAGAAAATAAAGGACAACGATGCCTAAATCCCAAATCGAAGCAAGCAAGGCTTATAATCAAATTGAAAGAAAGAATTTTTAAAAATATCAAAACATATGAAGTCCTGGAAAAGAGCATCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T68465-Ab | Anti-CXL11/ CXCL11/ H174 functional antibody |
Target Antigen | GM-Tg-g-T68465-Ag | CXCL11 protein |
Cytokine | cks-Tg-g-GM-T68465 | chemokine (C-X-C motif) ligand 11 (CXCL11) protein & antibody |
ORF Viral Vector | pGMLP004889 | Human CXCL11 Lentivirus plasmid |
ORF Viral Vector | vGMLP004889 | Human CXCL11 Lentivirus particle |
Target information
Target ID | GM-T68465 |
Target Name | CXCL11 |
Gene ID | 6373, 574372, 305236, 101099880, 119867221, 516104, 100629807 |
Gene Symbol and Synonyms | b-R1,CXCL11,H174,I-TAC,IP-9,IP9,SCYB11,SCYB9B |
Uniprot Accession | O14625 |
Uniprot Entry Name | CXL11_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000169248 |
Target Classification | Tumor-associated antigen (TAA) |
Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.