Human CXCL11/b-R1/ H174 ORF/cDNA clone-Lentivirus plasmid (NM_001302123)

Pre-made Human CXCL11/b-R1/ H174 Lentiviral expression plasmid for CXCL11 lentivirus packaging, CXCL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CXCL11/b-R1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004889 Human CXCL11 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004889
Gene Name CXCL11
Accession Number NM_001302123
Gene ID 6373
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 321 bp
Gene Alias b-R1, H174, I-TAC, IP-9, IP9, SCYB11, SCYB9B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTGATATTGTGTGCTACAGTTGTTCAAGGCTTCCCCATGTTCAAAAGAGGACGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAGAAAGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATAGAAGTGATTATTACCCTGAAAGAAAATAAAGGACAACGATGCCTAAATCCCAAATCGAAGCAAGCAAGGCTTATAATCAAATTGAAAGAAAGAATTTTTAAAAATATCAAAACATATGAAGTCCTGGAAAAGAGCATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68465-Ab Anti-CXL11/ CXCL11/ H174 functional antibody
    Target Antigen GM-Tg-g-T68465-Ag CXCL11 protein
    Cytokine cks-Tg-g-GM-T68465 chemokine (C-X-C motif) ligand 11 (CXCL11) protein & antibody
    ORF Viral Vector pGMLP004889 Human CXCL11 Lentivirus plasmid
    ORF Viral Vector vGMLP004889 Human CXCL11 Lentivirus particle


    Target information

    Target ID GM-T68465
    Target Name CXCL11
    Gene ID 6373, 574372, 305236, 101099880, 119867221, 516104, 100629807
    Gene Symbol and Synonyms b-R1,CXCL11,H174,I-TAC,IP-9,IP9,SCYB11,SCYB9B
    Uniprot Accession O14625
    Uniprot Entry Name CXL11_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000169248
    Target Classification Tumor-associated antigen (TAA)

    Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.