Human CFD/ADIPSIN/ ADN ORF/cDNA clone-Lentivirus plasmid (NM_001317335)

Pre-made Human CFD/ADIPSIN/ ADN Lentiviral expression plasmid for CFD lentivirus packaging, CFD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CFD/ADIPSIN products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004900 Human CFD Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004900
Gene Name CFD
Accession Number NM_001317335
Gene ID 1675
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 783 bp
Gene Alias ADIPSIN, ADN, DF, PFD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCACAGCTGGGAGCGCCTGGCAGTTCTGGTCCTCCTAGGAGCGGCCGCCTGCGGTGAGGAGGCCTGGGCCTGGGCGGCGCCGCCCCGTGGTCGGATCCTGGGCGGCAGAGAGGCCGAGGCGCACGCGCGGCCCTACATGGCGTCGGTGCAGCTGAACGGCGCGCACCTGTGCGGCGGCGTCCTGGTGGCGGAGCAGTGGGTGCTGAGCGCGGCGCACTGCCTGGAGGACGCGGCCGACGGGAAGGTGCAGGTTCTCCTGGGCGCGCACTCCCTGTCGCAGCCGGAGCCCTCCAAGCGCCTGTACGACGTGCTCCGCGCAGTGCCCCACCCGGACAGCCAGCCCGACACCATCGACCACGACCTCCTGCTGCTACAGCTGTCGGAGAAGGCCACACTGGGCCCTGCTGTGCGCCCCCTGCCCTGGCAGCGCGTGGACCGCGACGTGGCACCGGGAACTCTCTGCGACGTGGCCGGCTGGGGCATAGTCAACCACGCGGGCCGCCGCCCGGACAGCCTGCAGCACGTGCTCTTGCCAGTGCTGGACCGCGCCACCTGCAACCGGCGCACGCACCACGACGGCGCCATCACCGAGCGCTTGATGTGCGCGGAGAGCAATCGCCGGGACAGCTGCAAGGGTGACTCCGGGGGCCCGCTGGTGTGCGGGGGCGTGCTCGAGGGCGTGGTCACCTCGGGCTCGCGCGTTTGCGGCAACCGCAAGAAGCCCGGGATCTACACCCGCGTGGCGAGCTATGCGGCCTGGATCGACAGCGTCCTGGCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-293 Pre-Made Lampalizumab biosimilar, Fab, Anti-CFD Antibody: Anti-ADIPSIN/ADN/DF/PFD therapeutic antibody
    Target Antibody GM-Tg-g-T66383-Ab Anti-CFAD/ CFD/ ADIPSIN functional antibody
    Target Antigen GM-Tg-g-T66383-Ag CFD protein
    Cytokine cks-Tg-g-GM-T66383 complement factor D (adipsin) (CFD) protein & antibody
    ORF Viral Vector pGMLP004900 Human CFD Lentivirus plasmid
    ORF Viral Vector vGMLP004900 Human CFD Lentivirus particle


    Target information

    Target ID GM-T66383
    Target Name CFD
    Gene ID 1675, 11537, 721138, 54249, 101093500, 485095, 505647, 111774154
    Gene Symbol and Synonyms ADIPSIN,ADN,CFD,DF,EVE,PFD
    Uniprot Accession P00746
    Uniprot Entry Name CFAD_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Dent disease
    Gene Ensembl ENSG00000197766
    Target Classification Not Available

    This gene encodes a member of the S1, or chymotrypsin, family of serine peptidases. This protease catalyzes the cleavage of factor B, the rate-limiting step of the alternative pathway of complement activation. This protein also functions as an adipokine, a cell signaling protein secreted by adipocytes, which regulates insulin secretion in mice. Mutations in this gene underlie complement factor D deficiency, which is associated with recurrent bacterial meningitis infections in human patients. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature protease. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.