Human CFD/ADIPSIN/ ADN ORF/cDNA clone-Lentivirus particle (NM_001317335)
Pre-made Human CFD/ADIPSIN/ ADN Lentiviral expression plasmid for CFD lentivirus packaging, CFD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CFD/ADIPSIN products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004900 | Human CFD Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004900 |
Gene Name | CFD |
Accession Number | NM_001317335 |
Gene ID | 1675 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 783 bp |
Gene Alias | ADIPSIN, ADN, DF, PFD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCACAGCTGGGAGCGCCTGGCAGTTCTGGTCCTCCTAGGAGCGGCCGCCTGCGGTGAGGAGGCCTGGGCCTGGGCGGCGCCGCCCCGTGGTCGGATCCTGGGCGGCAGAGAGGCCGAGGCGCACGCGCGGCCCTACATGGCGTCGGTGCAGCTGAACGGCGCGCACCTGTGCGGCGGCGTCCTGGTGGCGGAGCAGTGGGTGCTGAGCGCGGCGCACTGCCTGGAGGACGCGGCCGACGGGAAGGTGCAGGTTCTCCTGGGCGCGCACTCCCTGTCGCAGCCGGAGCCCTCCAAGCGCCTGTACGACGTGCTCCGCGCAGTGCCCCACCCGGACAGCCAGCCCGACACCATCGACCACGACCTCCTGCTGCTACAGCTGTCGGAGAAGGCCACACTGGGCCCTGCTGTGCGCCCCCTGCCCTGGCAGCGCGTGGACCGCGACGTGGCACCGGGAACTCTCTGCGACGTGGCCGGCTGGGGCATAGTCAACCACGCGGGCCGCCGCCCGGACAGCCTGCAGCACGTGCTCTTGCCAGTGCTGGACCGCGCCACCTGCAACCGGCGCACGCACCACGACGGCGCCATCACCGAGCGCTTGATGTGCGCGGAGAGCAATCGCCGGGACAGCTGCAAGGGTGACTCCGGGGGCCCGCTGGTGTGCGGGGGCGTGCTCGAGGGCGTGGTCACCTCGGGCTCGCGCGTTTGCGGCAACCGCAAGAAGCCCGGGATCTACACCCGCGTGGCGAGCTATGCGGCCTGGATCGACAGCGTCCTGGCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-293 | Pre-Made Lampalizumab biosimilar, Fab, Anti-CFD Antibody: Anti-ADIPSIN/ADN/DF/PFD therapeutic antibody |
Target Antibody | GM-Tg-g-T66383-Ab | Anti-CFAD/ CFD/ ADIPSIN functional antibody |
Target Antigen | GM-Tg-g-T66383-Ag | CFD protein |
Cytokine | cks-Tg-g-GM-T66383 | complement factor D (adipsin) (CFD) protein & antibody |
ORF Viral Vector | pGMLP004900 | Human CFD Lentivirus plasmid |
ORF Viral Vector | vGMLP004900 | Human CFD Lentivirus particle |
Target information
Target ID | GM-T66383 |
Target Name | CFD |
Gene ID | 1675, 11537, 721138, 54249, 101093500, 485095, 505647, 111774154 |
Gene Symbol and Synonyms | ADIPSIN,ADN,CFD,DF,EVE,PFD |
Uniprot Accession | P00746 |
Uniprot Entry Name | CFAD_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Dent disease |
Gene Ensembl | ENSG00000197766 |
Target Classification | Not Available |
This gene encodes a member of the S1, or chymotrypsin, family of serine peptidases. This protease catalyzes the cleavage of factor B, the rate-limiting step of the alternative pathway of complement activation. This protein also functions as an adipokine, a cell signaling protein secreted by adipocytes, which regulates insulin secretion in mice. Mutations in this gene underlie complement factor D deficiency, which is associated with recurrent bacterial meningitis infections in human patients. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature protease. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.