Human ATRAID/APR--3/APR-3 ORF/cDNA clone-Lentivirus plasmid (NM_080592)

Cat. No.: pGMLP004902
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ATRAID/APR--3/APR-3 Lentiviral expression plasmid for ATRAID lentivirus packaging, ATRAID lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ATRAID/APR--3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $513.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004902
Gene Name ATRAID
Accession Number NM_080592
Gene ID 51374
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 855 bp
Gene Alias APR--3,APR-3,APR3,C2orf28,HSPC013,p18,PRO240
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGACCAGCGCAGAGCTCCACGAGCAGGAAAAGCCCCCAAGCAGCCCCAGGGCGACTGGACCGGGCCGCTTAGGCCACGCCCGGGGAAGAGGGCCTGACGCGCTGCGGGGCGGGGCCGCGGGGCCGGGTCGCGCGAGCAGCGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGACCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCCGCCCTGCTCCTCGCTCTGGGCGTGGAAAGGGCTCTGGCGCTACCCGAGATATGCACCCAATGTCCAGGGAGCGTGCAAAATTTGTCAAAAGTGGCCTTTTATTGTAAAACGACACGAGAGCTAATGCTGCATGCCCGTTGCTGCCTGAATCAGAAGGGCACCATCTTGGGGCTGGATCTCCAGAACTGTTCTCTGGAGGACCCTGGTCCAAACTTTCATCAGGCACATACCACTGTCATCATAGACCTGCAAGCAAACCCCCTCAAAGGTGACTTGGCCAACACCTTCCGTGGCTTTACTCAGCTCCAGACTCTGATACTGCCACAACATGTCAACTGTCCTGGAGGAATTAATGCCTGGAATACTATCACCTCTTATATAGACAACCAAATCTGTCAAGGGCAAAAGAACCTTTGCAATAACACTGGGGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAGGTCTTTTGCAGTGTGTTTGTGCTGATGGTTTCCATGGATACAAGTGTATGCGCCAGGGCTCGTTCTCACTGCTTATGTTCTTCGGGATTCTGGGAGCCACCACTCTATCCGTCTCCATTCTGCTTTGGGCGACCCAGCGCCGAAAAGCCAAGACTTCATGA
ORF Protein Sequence MKTSAELHEQEKPPSSPRATGPGRLGHARGRGPDALRGGAAGPGRASSGAPRERKMAPHDPGSLTTLVPWAAALLLALGVERALALPEICTQCPGSVQNLSKVAFYCKTTRELMLHARCCLNQKGTILGLDLQNCSLEDPGPNFHQAHTTVIIDLQANPLKGDLANTFRGFTQLQTLILPQHVNCPGGINAWNTITSYIDNQICQGQKNLCNNTGDPEMCPENGSCVPDGPGLLQCVCADGFHGYKCMRQGSFSLLMFFGILGATTLSVSILLWATQRRKAKTS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T96398-Ab Anti-ARAID/ ATRAID/ APR--3 monoclonal antibody
    Target Antigen GM-Tg-g-T96398-Ag ATRAID VLP (virus-like particle)
    ORF Viral Vector pGMLP004902 Human ATRAID Lentivirus plasmid
    ORF Viral Vector vGMLP004902 Human ATRAID Lentivirus particle


    Target information

    Target ID GM-T96398
    Target Name ATRAID
    Gene ID 51374, 381629, 699201, 298841, 101100124, 475699, 100125942, 100071247
    Gene Symbol and Synonyms 0610007C21Rik,APR--3,APR-3,APR3,ATRAID,C11H2orf28,C13H2orf28,C17H2orf28,C2orf28,HSPC013,p18,PRO240,RGD1311605
    Uniprot Accession Q6UW56
    Uniprot Entry Name ARAID_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000138085
    Target Classification Not Available

    This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.