Human FGF16/FGF-16/ MF4 ORF/cDNA clone-Lentivirus plasmid (NM_003868)

Pre-made Human FGF16/FGF-16/ MF4 Lentiviral expression plasmid for FGF16 lentivirus packaging, FGF16 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF16/FGF-16 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004959 Human FGF16 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004959
Gene Name FGF16
Accession Number NM_003868
Gene ID 8823
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 624 bp
Gene Alias FGF-16, MF4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCGTCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAAATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTAAAGGGGATCCTGCGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACGGTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCTGTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGAGGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAAGAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAGTATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACACCAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCCAGAGACCTCTTTCACTATAGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0917-Ab Anti-FGF16/ FGF-16/ MF4 functional antibody
    Target Antigen GM-Tg-g-SE0917-Ag FGF16 protein
    Cytokine cks-Tg-g-GM-SE0917 fibroblast growth factor 16 (FGF16) protein & antibody
    ORF Viral Vector pGMLP004959 Human FGF16 Lentivirus plasmid
    ORF Viral Vector vGMLP004959 Human FGF16 Lentivirus particle


    Target information

    Target ID GM-SE0917
    Target Name FGF16
    Gene ID 8823, 80903, 705612, 60464, 101084778, 491974, 540758, 100071790
    Gene Symbol and Synonyms FGF-16,FGF16,Fgf4c,MF4
    Uniprot Accession O43320
    Uniprot Entry Name FGF16_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000196468
    Target Classification Not Available

    This gene encodes a member of a family of proteins that are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene is expressed in cardiac cells and is required for proper heart development. Mutation in this gene was also observed in individuals with metacarpal 4-5 fusion. [provided by RefSeq, Mar 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.