Human MC5R/MC2 ORF/cDNA clone-Lentivirus plasmid (NM_005913)

Cat. No.: pGMLP004969
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MC5R/MC2 Lentiviral expression plasmid for MC5R lentivirus packaging, MC5R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MC5R/MC2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $544.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004969
Gene Name MC5R
Accession Number NM_005913
Gene ID 4161
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 978 bp
Gene Alias MC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATTCCTCATTTCACCTGCATTTCTTGGATCTCAACCTGAATGCCACAGAGGGCAACCTTTCAGGACCCAATGTCAAAAACAAGTCTTCACCATGTGAAGACATGGGCATTGCTGTGGAGGTGTTTCTCACTCTGGGTGTCATCAGCCTCTTGGAGAACATCTTGGTCATAGGGGCCATAGTGAAGAACAAAAACCTGCACTCCCCCATGTACTTCTTCGTGTGCAGCCTGGCAGTGGCGGACATGCTGGTGAGCATGTCCAGTGCCTGGGAGACCATCACCATCTACCTACTCAACAACAAGCACCTAGTGATAGCAGACGCCTTTGTGCGCCACATTGACAATGTGTTTGACTCCATGATCTGCATTTCCGTGGTGGCATCCATGTGCAGCTTACTGGCCATTGCAGTGGATAGGTACGTCACCATCTTCTACGCCCTGCGCTACCACCACATCATGACGGCGAGGCGCTCAGGGGCCATCATCGCCGGCATCTGGGCTTTCTGCACGGGCTGCGGCATTGTCTTCATCCTGTACTCAGAATCCACCTACGTCATCCTGTGCCTCATCTCCATGTTCTTCGCTATGCTGTTCCTCCTGGTGTCTCTGTACATACACATGTTCCTCCTGGCGCGGACTCACGTCAAGCGGATCGCGGCTCTGCCCGGGGCCAGCTCTGCGCGGCAGAGGACCAGCATGCAGGGCGCGGTCACCGTCACCATGCTGCTGGGCGTGTTTACCGTGTGCTGGGCCCCGTTCTTCCTTCATCTCACTTTAATGCTTTCTTGCCCTCAGAACCTCTACTGCTCTCGCTTCATGTCTCACTTCAATATGTACCTCATACTCATCATGTGTAATTCCGTGATGGACCCTCTCATATATGCCTTCCGCAGCCAAGAGATGCGGAAGACCTTTAAGGAGATTATTTGCTGCCGTGGTTTCAGGATCGCCTGCAGCTTTCCCAGAAGGGATTAA
ORF Protein Sequence MNSSFHLHFLDLNLNATEGNLSGPNVKNKSSPCEDMGIAVEVFLTLGVISLLENILVIGAIVKNKNLHSPMYFFVCSLAVADMLVSMSSAWETITIYLLNNKHLVIADAFVRHIDNVFDSMICISVVASMCSLLAIAVDRYVTIFYALRYHHIMTARRSGAIIAGIWAFCTGCGIVFILYSESTYVILCLISMFFAMLFLLVSLYIHMFLLARTHVKRIAALPGASSARQRTSMQGAVTVTMLLGVFTVCWAPFFLHLTLMLSCPQNLYCSRFMSHFNMYLILIMCNSVMDPLIYAFRSQEMRKTFKEIICCRGFRIACSFPRRD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T95302-Ab Anti-MC5R/ MC2 monoclonal antibody
    Target Antigen GM-Tg-g-T95302-Ag MC5R VLP (virus-like particle)
    ORF Viral Vector pGMLP004969 Human MC5R Lentivirus plasmid
    ORF Viral Vector vGMLP004969 Human MC5R Lentivirus particle


    Target information

    Target ID GM-T95302
    Target Name MC5R
    Gene ID 4161, 17203, 701447, 25726, 101093399, 483981, 507987, 106780948
    Gene Symbol and Synonyms MC2,MC5,MC5R
    Uniprot Accession P33032
    Uniprot Entry Name MC5R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000176136
    Target Classification GPCR

    This gene encodes a member of the seven-pass transmembrane G protein-coupled melanocortin receptor protein family that stimulate cAMP signal transduction. The encoded protein is a receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone and is suggested to play a role in sebum generation. [provided by RefSeq, Jun 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.