Human HOXA5/HOX1/HOX1.3 ORF/cDNA clone-Lentivirus plasmid (NM_019102)

Cat. No.: pGMLP004975
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HOXA5/HOX1/HOX1.3 Lentiviral expression plasmid for HOXA5 lentivirus packaging, HOXA5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HOXA5/HOX1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $503.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004975
Gene Name HOXA5
Accession Number NM_019102
Gene ID 3202
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 813 bp
Gene Alias HOX1,HOX1.3,HOX1C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCTTATTTTGTAAACTCATTTTGCGGTCGCTATCCAAATGGCCCGGACTACCAGTTGCATAATTATGGAGATCATAGTTCCGTGAGCGAGCAATTCAGGGACTCGGCGAGCATGCACTCCGGCAGGTACGGCTACGGCTACAATGGCATGGATCTCAGCGTCGGCCGCTCGGGCTCCGGCCACTTTGGCTCCGGAGAGCGCGCCCGCAGCTACGCTGCCAGCGCCAGCGCGGCGCCCGCCGAGCCCAGGTACAGCCAGCCGGCCACGTCCACGCACTCTCCTCAGCCCGATCCGCTGCCCTGCTCCGCCGTGGCCCCCTCGCCCGGCAGCGACAGCCACCACGGCGGGAAAAACTCCCTAAGCAACTCCAGCGGCGCCTCGGCCGACGCCGGCAGCACCCACATCAGCAGCAGAGAGGGGGTTGGCACGGCGTCCGGAGCCGAGGAGGACGCCCCTGCCAGCAGCGAGCAGGCGAGTGCGCAGAGCGAGCCGAGCCCGGCGCCGCCCGCCCAACCCCAGATCTACCCCTGGATGCGCAAGCTGCACATAAGTCATGACAACATAGGCGGCCCGGAAGGCAAAAGGGCCCGGACGGCCTACACGCGCTACCAGACCCTGGAGCTGGAGAAGGAGTTCCACTTCAACCGTTACCTGACCCGCAGAAGGAGGATTGAAATAGCACATGCTCTTTGCCTCTCCGAGAGACAAATTAAAATCTGGTTCCAAAACCGGAGAATGAAGTGGAAAAAAGATAATAAGCTGAAAAGCATGAGCATGGCCGCGGCAGGAGGGGCCTTCCGTCCCTGA
ORF Protein Sequence MSSYFVNSFCGRYPNGPDYQLHNYGDHSSVSEQFRDSASMHSGRYGYGYNGMDLSVGRSGSGHFGSGERARSYAASASAAPAEPRYSQPATSTHSPQPDPLPCSAVAPSPGSDSHHGGKNSLSNSSGASADAGSTHISSREGVGTASGAEEDAPASSEQASAQSEPSPAPPAQPQIYPWMRKLHISHDNIGGPEGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSMAAAGGAFRP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T08379-Ab Anti-HOXA5 monoclonal antibody
    Target Antigen GM-Tg-g-T08379-Ag HOXA5 protein
    ORF Viral Vector pGMLP004975 Human HOXA5 Lentivirus plasmid
    ORF Viral Vector vGMLP004975 Human HOXA5 Lentivirus particle


    Target information

    Target ID GM-T08379
    Target Name HOXA5
    Gene ID 3202, 15402, 700221, 79241, 101082992, 482370, 768039, 100054486
    Gene Symbol and Synonyms Hox-1.3,HOX1,HOX1.3,HOX1C,HOXA5
    Uniprot Accession P20719
    Uniprot Entry Name HXA5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000106004
    Target Classification Not Available

    In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.