Human HOXA5/HOX1/HOX1.3 ORF/cDNA clone-Lentivirus particle (NM_019102)
Cat. No.: vGMLP004975
Pre-made Human HOXA5/HOX1/HOX1.3 Lentiviral expression plasmid for HOXA5 lentivirus packaging, HOXA5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HOXA5/HOX1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004975 | Human HOXA5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004975 |
Gene Name | HOXA5 |
Accession Number | NM_019102 |
Gene ID | 3202 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 813 bp |
Gene Alias | HOX1,HOX1.3,HOX1C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCTCTTATTTTGTAAACTCATTTTGCGGTCGCTATCCAAATGGCCCGGACTACCAGTTGCATAATTATGGAGATCATAGTTCCGTGAGCGAGCAATTCAGGGACTCGGCGAGCATGCACTCCGGCAGGTACGGCTACGGCTACAATGGCATGGATCTCAGCGTCGGCCGCTCGGGCTCCGGCCACTTTGGCTCCGGAGAGCGCGCCCGCAGCTACGCTGCCAGCGCCAGCGCGGCGCCCGCCGAGCCCAGGTACAGCCAGCCGGCCACGTCCACGCACTCTCCTCAGCCCGATCCGCTGCCCTGCTCCGCCGTGGCCCCCTCGCCCGGCAGCGACAGCCACCACGGCGGGAAAAACTCCCTAAGCAACTCCAGCGGCGCCTCGGCCGACGCCGGCAGCACCCACATCAGCAGCAGAGAGGGGGTTGGCACGGCGTCCGGAGCCGAGGAGGACGCCCCTGCCAGCAGCGAGCAGGCGAGTGCGCAGAGCGAGCCGAGCCCGGCGCCGCCCGCCCAACCCCAGATCTACCCCTGGATGCGCAAGCTGCACATAAGTCATGACAACATAGGCGGCCCGGAAGGCAAAAGGGCCCGGACGGCCTACACGCGCTACCAGACCCTGGAGCTGGAGAAGGAGTTCCACTTCAACCGTTACCTGACCCGCAGAAGGAGGATTGAAATAGCACATGCTCTTTGCCTCTCCGAGAGACAAATTAAAATCTGGTTCCAAAACCGGAGAATGAAGTGGAAAAAAGATAATAAGCTGAAAAGCATGAGCATGGCCGCGGCAGGAGGGGCCTTCCGTCCCTGA |
ORF Protein Sequence | MSSYFVNSFCGRYPNGPDYQLHNYGDHSSVSEQFRDSASMHSGRYGYGYNGMDLSVGRSGSGHFGSGERARSYAASASAAPAEPRYSQPATSTHSPQPDPLPCSAVAPSPGSDSHHGGKNSLSNSSGASADAGSTHISSREGVGTASGAEEDAPASSEQASAQSEPSPAPPAQPQIYPWMRKLHISHDNIGGPEGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSMAAAGGAFRP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T08379-Ab | Anti-HOXA5 monoclonal antibody |
Target Antigen | GM-Tg-g-T08379-Ag | HOXA5 protein |
ORF Viral Vector | pGMLP004975 | Human HOXA5 Lentivirus plasmid |
ORF Viral Vector | vGMLP004975 | Human HOXA5 Lentivirus particle |
Target information
Target ID | GM-T08379 |
Target Name | HOXA5 |
Gene ID | 3202, 15402, 700221, 79241, 101082992, 482370, 768039, 100054486 |
Gene Symbol and Synonyms | Hox-1.3,HOX1,HOX1.3,HOX1C,HOXA5 |
Uniprot Accession | P20719 |
Uniprot Entry Name | HXA5_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000106004 |
Target Classification | Not Available |
In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.