Human IBSP/BNSP/BSP ORF/cDNA clone-Lentivirus plasmid (NM_004967)
Cat. No.: pGMLP004991
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IBSP/BNSP/BSP Lentiviral expression plasmid for IBSP lentivirus packaging, IBSP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IBSP/BNSP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004991 |
Gene Name | IBSP |
Accession Number | NM_004967 |
Gene ID | 3381 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 954 bp |
Gene Alias | BNSP,BSP,BSP-II,SP-II |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGACTGCTTTAATTTTGCTCAGCATTTTGGGAATGGCCTGTGCTTTCTCAATGAAAAATTTGCATCGAAGAGTCAAAATAGAGGATTCTGAAGAAAATGGGGTCTTTAAGTACAGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCCAGCTTCCCAAGAAGGCTGGGGATATAACAAATAAAGCTACAAAAGAGAAGGAAAGTGATGAAGAAGAAGAGGAGGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCAGAAGTGGATGAAAACGAACAAGGCATAAACGGCACCAGTACCAACAGCACAGAGGCAGAAAACGGCAACGGCAGCAGCGGAGGAGACAATGGAGAAGAAGGGGAAGAAGAAAGTGTCACTGGAGCCAATGCAGAAGACACCACAGAGACCGGAAGGCAGGGCAAGGGCACCTCGAAGACAACAACCTCTCCAAATGGTGGGTTTGAACCTACAACCCCACCACAAGTCTATAGAACCACTTCCCCACCTTTTGGGAAAACCACCACCGTTGAATACGAGGGGGAGTACGAATACACGGGCGCCAATGAATACGACAATGGATATGAAATCTATGAAAGTGAGAACGGGGAACCTCGTGGGGACAATTACCGAGCCTATGAAGATGAGTACAGCTACTTTAAAGGACAAGGCTACGATGGCTATGATGGTCAGAATTACTACCACCACCAGTGA |
ORF Protein Sequence | MKTALILLSILGMACAFSMKNLHRRVKIEDSEENGVFKYRPRYYLYKHAYFYPHLKRFPVQGSSDSSEENGDDSSEEEEEEEETSNEGENNEESNEDEDSEAENTTLSATTLGYGEDATPGTGYTGLAAIQLPKKAGDITNKATKEKESDEEEEEEEEGNENEESEAEVDENEQGINGTSTNSTEAENGNGSSGGDNGEEGEEESVTGANAEDTTETGRQGKGTSKTTTSPNGGFEPTTPPQVYRTTSPPFGKTTTVEYEGEYEYTGANEYDNGYEIYESENGEPRGDNYRAYEDEYSYFKGQGYDGYDGQNYYHHQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0974-Ab | Anti-SIAL/ IBSP/ BNSP functional antibody |
Target Antigen | GM-Tg-g-SE0974-Ag | IBSP protein |
ORF Viral Vector | pGMLP004991 | Human IBSP Lentivirus plasmid |
ORF Viral Vector | pGMPC000838 | Human IBSP Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP004991 | Human IBSP Lentivirus particle |
Target information
Target ID | GM-SE0974 |
Target Name | IBSP |
Gene ID | 3381, 15891, 701835, 24477, 101095252, 609146, 281233, 100052979 |
Gene Symbol and Synonyms | BNSP,BSP,BSP II,BSP-II,Bsp2,BSPII,IBSP,SP-II |
Uniprot Accession | P21815 |
Uniprot Entry Name | SIAL_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | breast cancer |
Gene Ensembl | ENSG00000029559 |
Target Classification | Not Available |
The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.