Human IBSP/BNSP/BSP ORF/cDNA clone-Lentivirus plasmid (NM_004967)

Cat. No.: pGMLP004991
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IBSP/BNSP/BSP Lentiviral expression plasmid for IBSP lentivirus packaging, IBSP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IBSP/BNSP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $538.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004991
Gene Name IBSP
Accession Number NM_004967
Gene ID 3381
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 954 bp
Gene Alias BNSP,BSP,BSP-II,SP-II
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGACTGCTTTAATTTTGCTCAGCATTTTGGGAATGGCCTGTGCTTTCTCAATGAAAAATTTGCATCGAAGAGTCAAAATAGAGGATTCTGAAGAAAATGGGGTCTTTAAGTACAGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCCAGCTTCCCAAGAAGGCTGGGGATATAACAAATAAAGCTACAAAAGAGAAGGAAAGTGATGAAGAAGAAGAGGAGGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCAGAAGTGGATGAAAACGAACAAGGCATAAACGGCACCAGTACCAACAGCACAGAGGCAGAAAACGGCAACGGCAGCAGCGGAGGAGACAATGGAGAAGAAGGGGAAGAAGAAAGTGTCACTGGAGCCAATGCAGAAGACACCACAGAGACCGGAAGGCAGGGCAAGGGCACCTCGAAGACAACAACCTCTCCAAATGGTGGGTTTGAACCTACAACCCCACCACAAGTCTATAGAACCACTTCCCCACCTTTTGGGAAAACCACCACCGTTGAATACGAGGGGGAGTACGAATACACGGGCGCCAATGAATACGACAATGGATATGAAATCTATGAAAGTGAGAACGGGGAACCTCGTGGGGACAATTACCGAGCCTATGAAGATGAGTACAGCTACTTTAAAGGACAAGGCTACGATGGCTATGATGGTCAGAATTACTACCACCACCAGTGA
ORF Protein Sequence MKTALILLSILGMACAFSMKNLHRRVKIEDSEENGVFKYRPRYYLYKHAYFYPHLKRFPVQGSSDSSEENGDDSSEEEEEEEETSNEGENNEESNEDEDSEAENTTLSATTLGYGEDATPGTGYTGLAAIQLPKKAGDITNKATKEKESDEEEEEEEEGNENEESEAEVDENEQGINGTSTNSTEAENGNGSSGGDNGEEGEEESVTGANAEDTTETGRQGKGTSKTTTSPNGGFEPTTPPQVYRTTSPPFGKTTTVEYEGEYEYTGANEYDNGYEIYESENGEPRGDNYRAYEDEYSYFKGQGYDGYDGQNYYHHQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0974-Ab Anti-SIAL/ IBSP/ BNSP functional antibody
    Target Antigen GM-Tg-g-SE0974-Ag IBSP protein
    ORF Viral Vector pGMLP004991 Human IBSP Lentivirus plasmid
    ORF Viral Vector pGMPC000838 Human IBSP Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004991 Human IBSP Lentivirus particle


    Target information

    Target ID GM-SE0974
    Target Name IBSP
    Gene ID 3381, 15891, 701835, 24477, 101095252, 609146, 281233, 100052979
    Gene Symbol and Synonyms BNSP,BSP,BSP II,BSP-II,Bsp2,BSPII,IBSP,SP-II
    Uniprot Accession P21815
    Uniprot Entry Name SIAL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease breast cancer
    Gene Ensembl ENSG00000029559
    Target Classification Not Available

    The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.