Human TRH/Pro-TRH/TRF ORF/cDNA clone-Lentivirus plasmid (NM_007117)

Cat. No.: pGMLP004993
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TRH/Pro-TRH/TRF Lentiviral expression plasmid for TRH lentivirus packaging, TRH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TRH/Pro-TRH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $482.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004993
Gene Name TRH
Accession Number NM_007117
Gene ID 7200
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 729 bp
Gene Alias Pro-TRH,TRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCGGCCCTTGGTTGCTGCTCGCTCTGGCTTTGACCCTGAACCTGACCGGTGTCCCCGGCGGCCGTGCTCAGCCAGAGGCGGCCCAGCAGGAGGCAGTGACGGCCGCGGAGCATCCGGGCCTGGATGACTTCCTGCGCCAGGTGGAGCGCCTCCTCTTCCTCCGGGAAAACATCCAGCGGCTGCAAGGGGACCAGGGTGAGCACTCCGCGTCCCAGATCTTTCAATCTGACTGGCTCTCCAAACGTCAGCATCCAGGCAAAAGAGAGGAGGAGGAGGAAGAGGGAGTTGAAGAAGAGGAAGAGGAAGAAGGGGGGGCTGTGGGACCCCACAAACGGCAGCACCCTGGCCGACGAGAAGATGAGGCTTCATGGTCAGTCGATGTAACCCAGCACAAGCGGCAGCATCCTGGCCGGCGCTCCCCCTGGCTTGCATATGCTGTCCCGAAGCGGCAGCACCCAGGCAGAAGGCTGGCAGATCCCAAGGCTCAAAGGAGCTGGGAAGAAGAGGAGGAGGAGGAAGAGAGAGAGGAAGACCTGATGCCTGAAAAACGCCAGCATCCGGGCAAGAGGGCCCTGGGAGGCCCCTGTGGGCCCCAGGGAGCCTATGGTCAAGCGGGCCTTCTGCTGGGGCTCCTGGATGACCTGAGTAGGAGCCAGGGAGCTGAGGAAAAGCGGCAGCACCCTGGTCGGCGGGCAGCCTGGGTCAGAGAGCCCCTGGAGGAGTGA
ORF Protein Sequence MPGPWLLLALALTLNLTGVPGGRAQPEAAQQEAVTAAEHPGLDDFLRQVERLLFLRENIQRLQGDQGEHSASQIFQSDWLSKRQHPGKREEEEEEGVEEEEEEEGGAVGPHKRQHPGRREDEASWSVDVTQHKRQHPGRRSPWLAYAVPKRQHPGRRLADPKAQRSWEEEEEEEEREEDLMPEKRQHPGKRALGGPCGPQGAYGQAGLLLGLLDDLSRSQGAEEKRQHPGRRAAWVREPLEE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58920-Ab Anti-TRH/ Pro-TRH/ TRF monoclonal antibody
    Target Antigen GM-Tg-g-T58920-Ag TRH VLP (virus-like particle)
    ORF Viral Vector pGMLP004993 Human TRH Lentivirus plasmid
    ORF Viral Vector vGMLP004993 Human TRH Lentivirus particle


    Target information

    Target ID GM-T58920
    Target Name TRH
    Gene ID 7200, 22044, 702455, 25569, 101099447, 100855474, 613414, 100056248
    Gene Symbol and Synonyms Pro-TRH,THR,TRF,TRH,TRH01
    Uniprot Accession P20396
    Uniprot Entry Name TRH_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170893
    Target Classification Not Available

    This gene encodes a member of the thyrotropin-releasing hormone family. Cleavage of the encoded proprotein releases mature thyrotropin-releasing hormone, which is a tripeptide hypothalamic regulatory hormone. The human proprotein contains six thyrotropin-releasing hormone tripeptides. Thyrotropin-releasing hormone is involved in the regulation and release of thyroid-stimulating hormone, as well as prolactin. Deficiency of this hormone has been associated with hypothalamic hypothyroidism. [provided by RefSeq, May 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.