Human TPSAB1/TPS1/ TPS2 ORF/cDNA clone-Lentivirus plasmid (NM_003294)

Pre-made Human TPSAB1/TPS1/ TPS2 Lentiviral expression plasmid for TPSAB1 lentivirus packaging, TPSAB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to Tryptase/TPSAB1/TPS1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004997 Human TPSAB1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004997
Gene Name TPSAB1
Accession Number NM_003294
Gene ID 7177
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 828 bp
Gene Alias TPS1, TPS2, TPSB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGAATCTGCTGCTGCTGGCGCTGCCCGTCCTGGCGAGCCGCGCCTACGCGGCCCCTGCCCCAGGCCAGGCCCTGCAGCGAGTGGGCATCGTCGGGGGTCAGGAGGCCCCCAGGAGCAAGTGGCCCTGGCAGGTGAGCCTGAGAGTCCACGGCCCATACTGGATGCACTTCTGCGGGGGCTCCCTCATCCACCCCCAGTGGGTGCTGACCGCAGCGCACTGCGTGGGACCGGACGTCAAGGATCTGGCCGCCCTCAGGGTGCAACTGCGGGAGCAGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCACCCACAGTTCTACACCGCCCAGATCGGAGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCGGTGAACGTCTCCAGCCACGTCCACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCCGGGGATGCCGTGCTGGGTCACTGGCTGGGGCGATGTGGACAATGATGAGCGCCTCCCACCGCCATTTCCTCTGAAGCAGGTGAAGGTCCCCATAATGGAAAACCACATTTGTGACGCAAAATACCACCTTGGCGCCTACACGGGAGACGACGTCCGCATCGTCCGTGACGACATGCTGTGTGCCGGGAACACCCGGAGGGACTCATGCCAGGGCGACTCCGGAGGGCCCCTGGTGTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGCGTGGTCAGCTGGGGCGAGGGCTGTGCCCAGCCCAACCGGCCTGGCATCTACACCCGTGTCACCTACTACTTGGACTGGATCCACCACTATGTCCCCAAAAAGCCGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T14558-Ab Anti-TRYB1/ Tryptase/ TPSAB1 functional antibody
    Target Antigen GM-Tg-g-T14558-Ag Tryptase/TPSAB1 protein
    ORF Viral Vector pGMLP004997 Human TPSAB1 Lentivirus plasmid
    ORF Viral Vector vGMLP004997 Human TPSAB1 Lentivirus particle


    Target information

    Target ID GM-T14558
    Target Name Tryptase
    Gene ID 7177
    Gene Symbol and Synonyms TPS1,TPS2,TPSAB1,TPSB1,TPSB2,Tryptase-2
    Uniprot Accession Q15661
    Uniprot Entry Name TRYB1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000172236
    Target Classification Not Available

    Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.