Human TPSAB1/TPS1/ TPS2 ORF/cDNA clone-Lentivirus particle (NM_003294)
Pre-made Human TPSAB1/TPS1/ TPS2 Lentiviral expression plasmid for TPSAB1 lentivirus packaging, TPSAB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to Tryptase/TPSAB1/TPS1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004997 | Human TPSAB1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004997 |
Gene Name | TPSAB1 |
Accession Number | NM_003294 |
Gene ID | 7177 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 828 bp |
Gene Alias | TPS1, TPS2, TPSB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGAATCTGCTGCTGCTGGCGCTGCCCGTCCTGGCGAGCCGCGCCTACGCGGCCCCTGCCCCAGGCCAGGCCCTGCAGCGAGTGGGCATCGTCGGGGGTCAGGAGGCCCCCAGGAGCAAGTGGCCCTGGCAGGTGAGCCTGAGAGTCCACGGCCCATACTGGATGCACTTCTGCGGGGGCTCCCTCATCCACCCCCAGTGGGTGCTGACCGCAGCGCACTGCGTGGGACCGGACGTCAAGGATCTGGCCGCCCTCAGGGTGCAACTGCGGGAGCAGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCACCCACAGTTCTACACCGCCCAGATCGGAGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCGGTGAACGTCTCCAGCCACGTCCACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCCGGGGATGCCGTGCTGGGTCACTGGCTGGGGCGATGTGGACAATGATGAGCGCCTCCCACCGCCATTTCCTCTGAAGCAGGTGAAGGTCCCCATAATGGAAAACCACATTTGTGACGCAAAATACCACCTTGGCGCCTACACGGGAGACGACGTCCGCATCGTCCGTGACGACATGCTGTGTGCCGGGAACACCCGGAGGGACTCATGCCAGGGCGACTCCGGAGGGCCCCTGGTGTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGCGTGGTCAGCTGGGGCGAGGGCTGTGCCCAGCCCAACCGGCCTGGCATCTACACCCGTGTCACCTACTACTTGGACTGGATCCACCACTATGTCCCCAAAAAGCCGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T14558-Ab | Anti-TRYB1/ Tryptase/ TPSAB1 functional antibody |
Target Antigen | GM-Tg-g-T14558-Ag | Tryptase/TPSAB1 protein |
ORF Viral Vector | pGMLP004997 | Human TPSAB1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004997 | Human TPSAB1 Lentivirus particle |
Target information
Target ID | GM-T14558 |
Target Name | Tryptase |
Gene ID | 7177 |
Gene Symbol and Synonyms | TPS1,TPS2,TPSAB1,TPSB1,TPSB2,Tryptase-2 |
Uniprot Accession | Q15661 |
Uniprot Entry Name | TRYB1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172236 |
Target Classification | Not Available |
Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.