Human HOXC11/HOX3H ORF/cDNA clone-Lentivirus plasmid (NM_014212)

Cat. No.: pGMLP005000
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HOXC11/HOX3H Lentiviral expression plasmid for HOXC11 lentivirus packaging, HOXC11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HOXC11/HOX3H products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $528.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005000
Gene Name HOXC11
Accession Number NM_014212
Gene ID 3227
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 915 bp
Gene Alias HOX3H
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTAACTCGGTCAACCTGGGCAACTTCTGCTCTCCGTCGCGCAAGGAGAGGGGCGCAGATTTCGGCGAGCGAGGGAGCTGCGCCTCCAACCTCTATCTGCCCAGTTGCACTTACTACATGCCCGAGTTCTCCACGGTCTCCTCCTTCCTGCCCCAGGCCCCCTCTCGTCAGATCTCCTATCCCTACTCGGCCCAAGTGCCCCCGGTCCGGGAGGTCTCCTACGGCCTGGAGCCATCCGGCAAGTGGCACCATCGGAACAGCTACTCCTCCTGCTATGCGGCGGCCGACGAGCTTATGCACCGGGAGTGCCTGCCTCCTTCCACCGTCACCGAGATCCTCATGAAAAACGAAGGCTCCTACGGCGGCCACCACCACCCCAGCGCCCCGCACGCAACCCCCGCCGGCTTCTACTCCTCAGTCAACAAGAACAGCGTCCTGCCTCAAGCCTTCGACCGTTTCTTCGACAACGCCTACTGCGGTGGCGGCGACCCGCCCGCCGAGCCCCCCTGCTCCGGCAAGGGCGAGGCCAAGGGGGAGCCCGAGGCACCCCCGGCCTCGGGACTGGCGTCCCGGGCTGAGGCGGGTGCCGAGGCGGAGGCTGAGGAGGAGAACACAAATCCCAGCTCGTCCGGTTCAGCCCACTCCGTGGCCAAGGAGCCGGCCAAAGGAGCCGCCCCCAACGCCCCCCGCACCCGCAAGAAGCGCTGCCCTTATTCGAAATTCCAGATCCGGGAACTGGAGCGAGAGTTTTTCTTCAACGTGTATATCAACAAAGAGAAGCGGCTGCAGCTGTCCCGGATGCTGAACCTGACGGACCGACAAGTGAAAATTTGGTTTCAGAACAGAAGGATGAAAGAAAAGAAACTGAGCAGAGACCGGCTGCAGTATTTCTCGGGAAATCCTCTGCTGTAA
ORF Protein Sequence MFNSVNLGNFCSPSRKERGADFGERGSCASNLYLPSCTYYMPEFSTVSSFLPQAPSRQISYPYSAQVPPVREVSYGLEPSGKWHHRNSYSSCYAAADELMHRECLPPSTVTEILMKNEGSYGGHHHPSAPHATPAGFYSSVNKNSVLPQAFDRFFDNAYCGGGDPPAEPPCSGKGEAKGEPEAPPASGLASRAEAGAEAEAEEENTNPSSSGSAHSVAKEPAKGAAPNAPRTRKKRCPYSKFQIRELEREFFFNVYINKEKRLQLSRMLNLTDRQVKIWFQNRRMKEKKLSRDRLQYFSGNPLL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0976-Ab Anti-HOXC11 monoclonal antibody
    Target Antigen GM-Tg-g-IP0976-Ag HOXC11 protein
    ORF Viral Vector pGMLP005000 Human HOXC11 Lentivirus plasmid
    ORF Viral Vector vGMLP005000 Human HOXC11 Lentivirus particle


    Target information

    Target ID GM-IP0976
    Target Name HOXC11
    Gene ID 3227, 109663, 106992375, 100911859, 101089530, 100688428, 536141, 100062371
    Gene Symbol and Synonyms Hox-3.7,HOX3H,HOXC11,RGD1305450
    Uniprot Accession O43248
    Uniprot Entry Name HXC11_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000123388
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene binds to a promoter element of the lactase-phlorizin hydrolase. It also may play a role in early intestinal development. An alternatively spliced variant encoding a shorter isoform has been described but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.