Human SOST/CDD/ DAND6 ORF/cDNA clone-Lentivirus plasmid (NM_025237)

Pre-made Human SOST/CDD/ DAND6 Lentiviral expression plasmid for SOST lentivirus packaging, SOST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SOST/CDD products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005026 Human SOST Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005026
Gene Name SOST
Accession Number NM_025237
Gene ID 50964
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 642 bp
Gene Alias CDD, DAND6, SOST1, VBCH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCTCCCACTGGCCCTGTGTCTCGTCTGCCTGCTGGTACACACAGCCTTCCGTGTAGTGGAGGGCCAGGGGTGGCAGGCGTTCAAGAATGATGCCACGGAAATCATCCCCGAGCTCGGAGAGTACCCCGAGCCTCCACCGGAGCTGGAGAACAACAAGACCATGAACCGGGCGGAGAACGGAGGGCGGCCTCCCCACCACCCCTTTGAGACCAAAGACGTGTCCGAGTACAGCTGCCGCGAGCTGCACTTCACCCGCTACGTGACCGATGGGCCGTGCCGCAGCGCCAAGCCGGTCACCGAGCTGGTGTGCTCCGGCCAGTGCGGCCCGGCGCGCCTGCTGCCCAACGCCATCGGCCGCGGCAAGTGGTGGCGACCTAGTGGGCCCGACTTCCGCTGCATCCCCGACCGCTACCGCGCGCAGCGCGTGCAGCTGCTGTGTCCCGGTGGTGAGGCGCCGCGCGCGCGCAAGGTGCGCCTGGTGGCCTCGTGCAAGTGCAAGCGCCTCACCCGCTTCCACAACCAGTCGGAGCTCAAGGACTTCGGGACCGAGGCCGCTCGGCCGCAGAAGGGCCGGAAGCCGCGGCCCCGCGCCCGGAGCGCCAAAGCCAACCAGGCCGAGCTGGAGAACGCCTACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-493 Pre-Made Romosozumab biosimilar, Whole mAb, Anti-SOST Antibody: Anti-CDD/DAND6/VBCH therapeutic antibody
    Biosimilar GMP-Bios-ab-076 Pre-Made Blosozumab biosimilar, Whole mAb, Anti-SOST Antibody: Anti-CDD/DAND6/VBCH therapeutic antibody
    Biosimilar GMP-Bios-ab-517 Pre-Made Setrusumab biosimilar, Whole mAb, Anti-SOST Antibody: Anti-CDD/DAND6/VBCH therapeutic antibody
    Target Antibody GM-Tg-g-T60724-Ab Anti-SOST/ CDD/ DAND61 functional antibody
    Target Antigen GM-Tg-g-T60724-Ag SOST protein
    ORF Viral Vector pGMLV000058 Human SOST Lentivirus plasmid
    ORF Viral Vector pGMLV000548 Human SOST Lentivirus plasmid
    ORF Viral Vector pGMAAV001255 Rat Sost Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000724 Human SOST Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP005026 Human SOST Lentivirus plasmid
    ORF Viral Vector vGMLV000058 Human SOST Lentivirus particle
    ORF Viral Vector vGMLV000548 Human SOST Lentivirus particle
    ORF Viral Vector vGMAAV001255 Rat Sost Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP005026 Human SOST Lentivirus particle


    Target information

    Target ID GM-T60724
    Target Name SOST
    Gene ID 50964, 74499, 713617, 80722, 101083725, 490948, 282880, 100065060
    Gene Symbol and Synonyms 5430411E23Rik,CDD,DAND6,SOST,SOST1,VBCH
    Uniprot Accession Q9BQB4
    Uniprot Entry Name SOST_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Breast Cancer
    Gene Ensembl ENSG00000167941
    Target Classification Not Available

    Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.