Human TWSG1/TSG ORF/cDNA clone-Lentivirus plasmid (NM_020648)

Pre-made Human TWSG1/TSG Lentiviral expression plasmid for TWSG1 lentivirus packaging, TWSG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TWSG1/TSG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005078 Human TWSG1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005078
Gene Name TWSG1
Accession Number NM_020648
Gene ID 57045
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias TSG
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTTACACTATGTTGCTGTGCTTACTCTAGCCATCCTGATGTTCCTGACATGGCTTCCAGAATCACTGAGCTGTAACAAAGCACTCTGTGCTAGTGATGTGAGCAAATGCCTCATTCAGGAGCTCTGCCAGTGCCGGCCGGGAGAAGGCAATTGCTCCTGCTGTAAGGAGTGCATGCTGTGTCTTGGGGCCCTTTGGGACGAGTGCTGTGACTGTGTTGGTATGTGTAATCCTCGAAATTATAGTGACACACCTCCAACTTCAAAGAGCACAGTGGAGGAGCTGCATGAACCGATCCCTTCTCTCTTCCGGGCACTCACAGAAGGAGATACTCAGTTGAATTGGAACATCGTTTCTTTCCCTGTTGCAGAAGAACTTTCACATCATGAGAATCTGGTTTCATTTTTAGAAACTGTGAACCAGCCACACCACCAGAATGTGTCTGTCCCCAGCAATAATGTTCACGCGCCTTATTCCAGTGACAAAGAACACATGTGTACTGTGGTTTATTTTGATGACTGCATGTCCATACATCAGTGTAAAATATCCTGTGAGTCCATGGGAGCATCCAAATATCGCTGGTTTCATAATGCCTGCTGCGAGTGCATTGGTCCAGAATGTATTGACTATGGTAGTAAAACTGTCAAATGTATGAACTGCATGTTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1354-Ab Anti-TWSG1/ TSG functional antibody
    Target Antigen GM-Tg-g-SE1354-Ag TWSG1 protein
    ORF Viral Vector pGMLP005078 Human TWSG1 Lentivirus plasmid
    ORF Viral Vector vGMLP005078 Human TWSG1 Lentivirus particle


    Target information

    Target ID GM-SE1354
    Target Name TWSG1
    Gene ID 57045, 65960, 705804, 363294, 101101257, 490546, 537290, 100054712
    Gene Symbol and Synonyms 1810013J15Rik,9030422N06Rik,D17Ertd403e,TSG,Twg,TWSG1
    Uniprot Accession Q9GZX9
    Uniprot Entry Name TWSG1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000128791
    Target Classification Not Available

    Enables transforming growth factor beta binding activity. Involved in several processes, including negative regulation of CD4-positive, alpha-beta T cell proliferation; positive regulation of pathway-restricted SMAD protein phosphorylation; and transforming growth factor beta receptor signaling pathway. Predicted to be located in extracellular region. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.