Human MPL/C-MPL/ CD110 ORF/cDNA clone-Lentivirus plasmid (NM_005373)
Pre-made Human MPL/C-MPL/ CD110 Lentiviral expression plasmid for MPL lentivirus packaging, MPL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MPL/C-MPL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP005099 | Human MPL Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP005099 |
Gene Name | MPL |
Accession Number | NM_005373 |
Gene ID | 4352 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1908 bp |
Gene Alias | C-MPL, CD110, MPLV, THCYT2, TPOR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCTCCTGGGCCCTCTTCATGGTCACCTCCTGCCTCCTCCTGGCCCCTCAAAACCTGGCCCAAGTCAGCAGCCAAGATGTCTCCTTGCTGGCATCAGACTCAGAGCCCCTGAAGTGTTTCTCCCGAACATTTGAGGACCTCACTTGCTTCTGGGATGAGGAAGAGGCAGCGCCCAGTGGGACATACCAGCTGCTGTATGCCTACCCGCGGGAGAAGCCCCGTGCTTGCCCCCTGAGTTCCCAGAGCATGCCCCACTTTGGAACCCGATACGTGTGCCAGTTTCCAGACCAGGAGGAAGTGCGTCTCTTCTTTCCGCTGCACCTCTGGGTGAAGAATGTGTTCCTAAACCAGACTCGGACTCAGCGAGTCCTCTTTGTGGACAGTGTAGGCCTGCCGGCTCCCCCCAGTATCATCAAGGCCATGGGTGGGAGCCAGCCAGGGGAACTTCAGATCAGCTGGGAGGAGCCAGCTCCAGAAATCAGTGATTTCCTGAGGTACGAACTCCGCTATGGCCCCAGAGATCCCAAGAACTCCACTGGTCCCACGGTCATACAGCTGATTGCCACAGAAACCTGCTGCCCTGCTCTGCAGAGGCCTCACTCAGCCTCTGCTCTGGACCAGTCTCCATGTGCTCAGCCCACAATGCCCTGGCAAGATGGACCAAAGCAGACCTCCCCAAGTAGAGAAGCTTCAGCTCTGACAGCAGAGGGTGGAAGCTGCCTCATCTCAGGACTCCAGCCTGGCAACTCCTACTGGCTGCAGCTGCGCAGCGAACCTGATGGGATCTCCCTCGGTGGCTCCTGGGGATCCTGGTCCCTCCCTGTGACTGTGGACCTGCCTGGAGATGCAGTGGCACTTGGACTGCAATGCTTTACCTTGGACCTGAAGAATGTTACCTGTCAATGGCAGCAACAGGACCATGCTAGCTCCCAAGGCTTCTTCTACCACAGCAGGGCACGGTGCTGCCCCAGAGACAGGTACCCCATCTGGGAGAACTGCGAAGAGGAAGAGAAAACAAATCCAGGACTACAGACCCCACAGTTCTCTCGCTGCCACTTCAAGTCACGAAATGACAGCATTATTCACATCCTTGTGGAGGTGACCACAGCCCCGGGTACTGTTCACAGCTACCTGGGCTCCCCTTTCTGGATCCACCAGGCTGTGCGCCTCCCCACCCCAAACTTGCACTGGAGGGAGATCTCCAGTGGGCATCTGGAATTGGAGTGGCAGCACCCATCGTCCTGGGCAGCCCAAGAGACCTGTTATCAACTCCGATACACAGGAGAAGGCCATCAGGACTGGAAGGTGCTGGAGCCGCCTCTCGGGGCCCGAGGAGGGACCCTGGAGCTGCGCCCGCGATCTCGCTACCGTTTACAGCTGCGCGCCAGGCTCAACGGCCCCACCTACCAAGGTCCCTGGAGCTCGTGGTCGGACCCAACTAGGGTGGAGACCGCCACCGAGACCGCCTGGATCTCCTTGGTGACCGCTCTGCATCTAGTGCTGGGCCTCAGCGCCGTCCTGGGCCTGCTGCTGCTGAGGTGGCAGTTTCCTGCACACTACAGGAGACTGAGGCATGCCCTGTGGCCCTCACTTCCAGACCTGCACCGGGTCCTAGGCCAGTACCTTAGGGACACTGCAGCCCTGAGCCCGCCCAAGGCCACAGTCTCAGATACCTGTGAAGAAGTGGAACCCAGCCTCCTTGAAATCCTCCCCAAGTCCTCAGAGAGGACTCCTTTGCCCCTGTGTTCCTCCCAGGCCCAGATGGACTACCGAAGATTGCAGCCTTCTTGCCTGGGGACCATGCCCCTGTCTGTGTGCCCACCCATGGCTGAGTCAGGGTCCTGCTGTACCACCCACATTGCCAACCATTCCTACCTACCACTAAGCTATTGGCAGCAGCCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-977 | Pre-Made Romiplostim Biosimilar, Fusion Protein targeting MPL fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting C-MPL/CD110/MPLV/THCYT2/THPOR/TPOR |
Target Antibody | GM-Tg-g-T16156-Ab | Anti-TPOR/ MPL/ C-MPL monoclonal antibody |
Target Antigen | GM-Tg-g-T16156-Ag | MPL VLP (virus-like particle) |
ORF Viral Vector | pGMLP005099 | Human MPL Lentivirus plasmid |
ORF Viral Vector | vGMLP005099 | Human MPL Lentivirus particle |
Target information
Target ID | GM-T16156 |
Target Name | MPL |
Gene ID | 4352, 17480, 366455, 101097002, 610801, 528492, 100066544 |
Gene Symbol and Synonyms | C-MPL,CD110,hlb219,MPL,MPLV,THCYT2,THPOR,TPO-R,TPOR |
Uniprot Accession | P40238 |
Uniprot Entry Name | TPOR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000117400 |
Target Classification | Cytokine Receptor, Tumor-associated antigen (TAA) |
In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.