Human MPL/C-MPL/ CD110 ORF/cDNA clone-Lentivirus plasmid (NM_005373)

Pre-made Human MPL/C-MPL/ CD110 Lentiviral expression plasmid for MPL lentivirus packaging, MPL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MPL/C-MPL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005099 Human MPL Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005099
Gene Name MPL
Accession Number NM_005373
Gene ID 4352
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1908 bp
Gene Alias C-MPL, CD110, MPLV, THCYT2, TPOR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCTCCTGGGCCCTCTTCATGGTCACCTCCTGCCTCCTCCTGGCCCCTCAAAACCTGGCCCAAGTCAGCAGCCAAGATGTCTCCTTGCTGGCATCAGACTCAGAGCCCCTGAAGTGTTTCTCCCGAACATTTGAGGACCTCACTTGCTTCTGGGATGAGGAAGAGGCAGCGCCCAGTGGGACATACCAGCTGCTGTATGCCTACCCGCGGGAGAAGCCCCGTGCTTGCCCCCTGAGTTCCCAGAGCATGCCCCACTTTGGAACCCGATACGTGTGCCAGTTTCCAGACCAGGAGGAAGTGCGTCTCTTCTTTCCGCTGCACCTCTGGGTGAAGAATGTGTTCCTAAACCAGACTCGGACTCAGCGAGTCCTCTTTGTGGACAGTGTAGGCCTGCCGGCTCCCCCCAGTATCATCAAGGCCATGGGTGGGAGCCAGCCAGGGGAACTTCAGATCAGCTGGGAGGAGCCAGCTCCAGAAATCAGTGATTTCCTGAGGTACGAACTCCGCTATGGCCCCAGAGATCCCAAGAACTCCACTGGTCCCACGGTCATACAGCTGATTGCCACAGAAACCTGCTGCCCTGCTCTGCAGAGGCCTCACTCAGCCTCTGCTCTGGACCAGTCTCCATGTGCTCAGCCCACAATGCCCTGGCAAGATGGACCAAAGCAGACCTCCCCAAGTAGAGAAGCTTCAGCTCTGACAGCAGAGGGTGGAAGCTGCCTCATCTCAGGACTCCAGCCTGGCAACTCCTACTGGCTGCAGCTGCGCAGCGAACCTGATGGGATCTCCCTCGGTGGCTCCTGGGGATCCTGGTCCCTCCCTGTGACTGTGGACCTGCCTGGAGATGCAGTGGCACTTGGACTGCAATGCTTTACCTTGGACCTGAAGAATGTTACCTGTCAATGGCAGCAACAGGACCATGCTAGCTCCCAAGGCTTCTTCTACCACAGCAGGGCACGGTGCTGCCCCAGAGACAGGTACCCCATCTGGGAGAACTGCGAAGAGGAAGAGAAAACAAATCCAGGACTACAGACCCCACAGTTCTCTCGCTGCCACTTCAAGTCACGAAATGACAGCATTATTCACATCCTTGTGGAGGTGACCACAGCCCCGGGTACTGTTCACAGCTACCTGGGCTCCCCTTTCTGGATCCACCAGGCTGTGCGCCTCCCCACCCCAAACTTGCACTGGAGGGAGATCTCCAGTGGGCATCTGGAATTGGAGTGGCAGCACCCATCGTCCTGGGCAGCCCAAGAGACCTGTTATCAACTCCGATACACAGGAGAAGGCCATCAGGACTGGAAGGTGCTGGAGCCGCCTCTCGGGGCCCGAGGAGGGACCCTGGAGCTGCGCCCGCGATCTCGCTACCGTTTACAGCTGCGCGCCAGGCTCAACGGCCCCACCTACCAAGGTCCCTGGAGCTCGTGGTCGGACCCAACTAGGGTGGAGACCGCCACCGAGACCGCCTGGATCTCCTTGGTGACCGCTCTGCATCTAGTGCTGGGCCTCAGCGCCGTCCTGGGCCTGCTGCTGCTGAGGTGGCAGTTTCCTGCACACTACAGGAGACTGAGGCATGCCCTGTGGCCCTCACTTCCAGACCTGCACCGGGTCCTAGGCCAGTACCTTAGGGACACTGCAGCCCTGAGCCCGCCCAAGGCCACAGTCTCAGATACCTGTGAAGAAGTGGAACCCAGCCTCCTTGAAATCCTCCCCAAGTCCTCAGAGAGGACTCCTTTGCCCCTGTGTTCCTCCCAGGCCCAGATGGACTACCGAAGATTGCAGCCTTCTTGCCTGGGGACCATGCCCCTGTCTGTGTGCCCACCCATGGCTGAGTCAGGGTCCTGCTGTACCACCCACATTGCCAACCATTCCTACCTACCACTAAGCTATTGGCAGCAGCCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-977 Pre-Made Romiplostim Biosimilar, Fusion Protein targeting MPL fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting C-MPL/CD110/MPLV/THCYT2/THPOR/TPOR
    Target Antibody GM-Tg-g-T16156-Ab Anti-TPOR/ MPL/ C-MPL monoclonal antibody
    Target Antigen GM-Tg-g-T16156-Ag MPL VLP (virus-like particle)
    ORF Viral Vector pGMLP005099 Human MPL Lentivirus plasmid
    ORF Viral Vector vGMLP005099 Human MPL Lentivirus particle


    Target information

    Target ID GM-T16156
    Target Name MPL
    Gene ID 4352, 17480, 366455, 101097002, 610801, 528492, 100066544
    Gene Symbol and Synonyms C-MPL,CD110,hlb219,MPL,MPLV,THCYT2,THPOR,TPO-R,TPOR
    Uniprot Accession P40238
    Uniprot Entry Name TPOR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000117400
    Target Classification Cytokine Receptor, Tumor-associated antigen (TAA)

    In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.