Human CSNK1A1/CK1/CK1a ORF/cDNA clone-Lentivirus plasmid (NM_001892.5)
Cat. No.: pGMLP005185
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CSNK1A1/CK1/CK1a Lentiviral expression plasmid for CSNK1A1 lentivirus packaging, CSNK1A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CSNK1A1/CK1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005185 |
Gene Name | CSNK1A1 |
Accession Number | NM_001892.5 |
Gene ID | 1452 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1014 bp |
Gene Alias | CK1,CK1a,CKIa,HEL-S-77p,HLCDGP1,PRO2975 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTCTTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCAGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAA |
ORF Protein Sequence | MASSSGSKAEFIVGGKYKLVRKIGSGSFGDIYLAINITNGEEVAVKLESQKARHPQLLYESKLYKILQGGVGIPHIRWYGQEKDYNVLVMDLLGPSLEDLFNFCSRRFTMKTVLMLADQMISRIEYVHTKNFIHRDIKPDNFLMGIGRHCNKLFLIDFGLAKKYRDNRTRQHIPYREDKNLTGTARYASINAHLGIEQSRRDDMESLGYVLMYFNRTSLPWQGLKAATKKQKYEKISEKKMSTPVEVLCKGFPAEFAMYLNYCRGLRFEEAPDYMYLRQLFRILFRTLNHQYDYTFDWTMLKQKAAQQAASSSGQGQQAQTPTGKQTDKTKSNMKGF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0122-Ab | Anti-CSNK1A1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0122-Ag | CSNK1A1 protein |
ORF Viral Vector | pGMLP005185 | Human CSNK1A1 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-090 | Human CSNK1A1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-230 | Human CSNK1A1 Adenovirus plasmid |
ORF Viral Vector | vGMLP005185 | Human CSNK1A1 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-090 | Human CSNK1A1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-230 | Human CSNK1A1 Adenovirus particle |
Target information
Target ID | GM-IP0122 |
Target Name | CSNK1A1 |
Gene ID | 1452, 93687, 710775, 113927, 101085602, 479331, 282684, 100060556 |
Gene Symbol and Synonyms | 2610208K14Rik,4632404G05Rik,5430427P18Rik,CK1,CK1a,CKIa,Csnk1a,CSNK1A1,HEL-S-77p,HLCDGP1,PRO2975 |
Uniprot Accession | P48729 |
Uniprot Entry Name | KC1A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000113712 |
Target Classification | Kinase |
Enables protein serine/threonine kinase activity. Involved in several processes, including negative regulation of canonical Wnt signaling pathway; peptidyl-serine phosphorylation; and positive regulation of proteasomal ubiquitin-dependent protein catabolic process. Located in centrosome; cytosol; and nuclear speck. Part of beta-catenin destruction complex. Colocalizes with keratin filament and mRNA cleavage and polyadenylation specificity factor complex. Biomarker of Alzheimer's disease and inclusion body myositis. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.