Human CSNK1A1/CK1/CK1a ORF/cDNA clone-Lentivirus particle (NM_001892.5)

Cat. No.: vGMLP005185

Pre-made Human CSNK1A1/CK1/CK1a Lentiviral expression plasmid for CSNK1A1 lentivirus packaging, CSNK1A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CSNK1A1/CK1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005185 Human CSNK1A1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005185
Gene Name CSNK1A1
Accession Number NM_001892.5
Gene ID 1452
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1014 bp
Gene Alias CK1,CK1a,CKIa,HEL-S-77p,HLCDGP1,PRO2975
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTCTTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCAGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAA
ORF Protein Sequence MASSSGSKAEFIVGGKYKLVRKIGSGSFGDIYLAINITNGEEVAVKLESQKARHPQLLYESKLYKILQGGVGIPHIRWYGQEKDYNVLVMDLLGPSLEDLFNFCSRRFTMKTVLMLADQMISRIEYVHTKNFIHRDIKPDNFLMGIGRHCNKLFLIDFGLAKKYRDNRTRQHIPYREDKNLTGTARYASINAHLGIEQSRRDDMESLGYVLMYFNRTSLPWQGLKAATKKQKYEKISEKKMSTPVEVLCKGFPAEFAMYLNYCRGLRFEEAPDYMYLRQLFRILFRTLNHQYDYTFDWTMLKQKAAQQAASSSGQGQQAQTPTGKQTDKTKSNMKGF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0122-Ab Anti-CSNK1A1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0122-Ag CSNK1A1 protein
    ORF Viral Vector pGMLP005185 Human CSNK1A1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-090 Human CSNK1A1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-230 Human CSNK1A1 Adenovirus plasmid
    ORF Viral Vector vGMLP005185 Human CSNK1A1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-090 Human CSNK1A1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-230 Human CSNK1A1 Adenovirus particle


    Target information

    Target ID GM-IP0122
    Target Name CSNK1A1
    Gene ID 1452, 93687, 710775, 113927, 101085602, 479331, 282684, 100060556
    Gene Symbol and Synonyms 2610208K14Rik,4632404G05Rik,5430427P18Rik,CK1,CK1a,CKIa,Csnk1a,CSNK1A1,HEL-S-77p,HLCDGP1,PRO2975
    Uniprot Accession P48729
    Uniprot Entry Name KC1A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000113712
    Target Classification Kinase

    Enables protein serine/threonine kinase activity. Involved in several processes, including negative regulation of canonical Wnt signaling pathway; peptidyl-serine phosphorylation; and positive regulation of proteasomal ubiquitin-dependent protein catabolic process. Located in centrosome; cytosol; and nuclear speck. Part of beta-catenin destruction complex. Colocalizes with keratin filament and mRNA cleavage and polyadenylation specificity factor complex. Biomarker of Alzheimer's disease and inclusion body myositis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.