Human PFKFB3/iPFK-2/IPFK2 ORF/cDNA clone-Lentivirus plasmid (NM_004566.3)

Cat. No.: pGMLP005289
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PFKFB3/iPFK-2/IPFK2 Lentiviral expression plasmid for PFKFB3 lentivirus packaging, PFKFB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PFKFB3/iPFK-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $784.53
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005289
Gene Name PFKFB3
Accession Number NM_004566.3
Gene ID 5209
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1563 bp
Gene Alias iPFK-2,IPFK2,PFK2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGTTGGAACTGACGCAGAGCCGAGTGCAGAAGATCTGGGTGCCCGTGGACCACAGGCCCTCGTTGCCCAGATCCTGTGGGCCAAAGCTGACCAACTCCCCCACCGTCATCGTCATGGTGGGCCTCCCCGCCCGGGGCAAGACCTACATCTCCAAGAAGCTGACTCGCTACCTCAACTGGATTGGCGTCCCCACAAAAGTGTTCAACGTCGGGGAGTATCGCCGGGAGGCTGTGAAGCAGTACAGCTCCTACAACTTCTTCCGCCCCGACAATGAGGAAGCCATGAAAGTCCGGAAGCAATGTGCCTTAGCTGCCTTGAGAGATGTCAAAAGCTACCTGGCGAAAGAAGGGGGACAAATTGCGGTTTTCGATGCCACCAATACTACTAGAGAGAGGAGACACATGATCCTTCATTTTGCCAAAGAAAATGACTTTAAGGCGTTTTTCATCGAGTCGGTGTGCGACGACCCTACAGTTGTGGCCTCCAATATCATGGAAGTTAAAATCTCCAGCCCGGATTACAAAGACTGCAACTCGGCAGAAGCCATGGACGACTTCATGAAGAGGATCAGTTGCTATGAAGCCAGCTACCAGCCCCTCGACCCCGACAAATGCGACAGGGACTTGTCGCTGATCAAGGTGATTGACGTGGGCCGGAGGTTCCTGGTGAACCGGGTGCAGGACCACATCCAGAGCCGCATCGTGTACTACCTGATGAACATCCACGTGCAGCCGCGTACCATCTACCTGTGCCGGCACGGCGAGAACGAGCACAACCTCCAGGGCCGCATCGGGGGCGACTCAGGCCTGTCCAGCCGGGGCAAGAAGTTTGCCAGTGCTCTGAGCAAGTTCGTGGAGGAGCAGAACCTGAAGGACCTGCGCGTGTGGACCAGCCAGCTGAAGAGCACCATCCAGACGGCCGAGGCGCTGCGGCTGCCCTACGAGCAGTGGAAGGCGCTCAATGAGATCGACGCGGGCGTCTGTGAGGAGCTGACCTACGAGGAGATCAGGGACACCTACCCTGAGGAGTATGCGCTGCGGGAGCAGGACAAGTACTATTACCGCTACCCCACCGGGGAGTCCTACCAGGACCTGGTCCAGCGCTTGGAGCCAGTGATCATGGAGCTGGAGCGGCAGGAGAATGTGCTGGTCATCTGCCACCAGGCCGTCCTGCGCTGCCTGCTTGCCTACTTCCTGGATAAGAGTGCAGAGGAGATGCCCTACCTGAAATGCCCTCTTCACACCGTCCTGAAACTGACGCCTGTCGCTTATGGCTGCCGTGTGGAATCCATCTACCTGAACGTGGAGTCCGTCTGCACACACCGGGAGAGGTCAGAGGATGCAAAGAAGGGACCTAACCCGCTCATGAGACGCAATAGTGTCACCCCGCTAGCCAGCCCCGAACCCACCAAAAAGCCTCGCATCAACAGCTTTGAGGAGCATGTGGCCTCCACCTCGGCCGCCCTGCCCAGCTGCCTGCCCCCGGAGGTGCCCACGCAGCTGCCTGGACAAAACATGAAAGGCTCCCGGAGCAGCGCTGACTCCTCCAGGAAACACTGA
ORF Protein Sequence MPLELTQSRVQKIWVPVDHRPSLPRSCGPKLTNSPTVIVMVGLPARGKTYISKKLTRYLNWIGVPTKVFNVGEYRREAVKQYSSYNFFRPDNEEAMKVRKQCALAALRDVKSYLAKEGGQIAVFDATNTTRERRHMILHFAKENDFKAFFIESVCDDPTVVASNIMEVKISSPDYKDCNSAEAMDDFMKRISCYEASYQPLDPDKCDRDLSLIKVIDVGRRFLVNRVQDHIQSRIVYYLMNIHVQPRTIYLCRHGENEHNLQGRIGGDSGLSSRGKKFASALSKFVEEQNLKDLRVWTSQLKSTIQTAEALRLPYEQWKALNEIDAGVCEELTYEEIRDTYPEEYALREQDKYYYRYPTGESYQDLVQRLEPVIMELERQENVLVICHQAVLRCLLAYFLDKSAEEMPYLKCPLHTVLKLTPVAYGCRVESIYLNVESVCTHRERSEDAKKGPNPLMRRNSVTPLASPEPTKKPRINSFEEHVASTSAALPSCLPPEVPTQLPGQNMKGSRSSADSSRKH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23787-Ab Anti-PFKFB3 monoclonal antibody
    Target Antigen GM-Tg-g-T23787-Ag PFKFB3 protein
    ORF Viral Vector pGMLP000744 Human PFKFB3 Lentivirus plasmid
    ORF Viral Vector pGMLP005289 Human PFKFB3 Lentivirus plasmid
    ORF Viral Vector pGMAAV001756 Human PFKFB3 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP000744 Human PFKFB3 Lentivirus particle
    ORF Viral Vector vGMLP005289 Human PFKFB3 Lentivirus particle
    ORF Viral Vector vGMAAV001756 Human PFKFB3 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T23787
    Target Name PFKFB3
    Gene ID 5209, 170768, 713062, 117276, 101100062, 487139, 407183, 100070251
    Gene Symbol and Synonyms E330010H22Rik,iPFK-2,IPFK2,PFK2,PFKFB3,uPFK-2
    Uniprot Accession Q16875
    Uniprot Entry Name F263_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170525
    Target Classification Not Available

    The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.